Incidental Mutation 'R9629:Itgb5'
ID 725390
Institutional Source Beutler Lab
Gene Symbol Itgb5
Ensembl Gene ENSMUSG00000022817
Gene Name integrin beta 5
Synonyms ESTM23, [b]-5, beta-5, beta5, [b]5, [b]5A, [b]5B
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9629 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 33829665-33949338 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 33875925 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 162 (T162I)
Ref Sequence ENSEMBL: ENSMUSP00000069416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069345] [ENSMUST00000115028]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000069345
AA Change: T162I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069416
Gene: ENSMUSG00000022817
AA Change: T162I

DomainStartEndE-ValueType
PSI 27 76 1.4e-7 SMART
INB 35 463 1.18e-284 SMART
VWA 137 372 5.95e-7 SMART
internal_repeat_1 492 549 3.16e-7 PROSPERO
EGF 554 586 1.95e1 SMART
Integrin_B_tail 635 719 1.56e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115028
AA Change: T162I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110680
Gene: ENSMUSG00000022817
AA Change: T162I

DomainStartEndE-ValueType
PSI 27 76 1.4e-7 SMART
INB 35 463 1.18e-284 SMART
VWA 137 372 5.95e-7 SMART
internal_repeat_1 492 549 3.16e-7 PROSPERO
EGF 554 586 1.95e1 SMART
Integrin_B_tail 635 719 1.56e-21 SMART
Integrin_b_cyt 743 790 5.97e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation do not appear to differ from normal in respect to development, reproduction, adenovirus infection, or wound healing. Mutant keratinocytes do show reduced migration on, and adhesion to, vitronectin in vitro. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T C 14: 35,810,177 E147G probably damaging Het
Agrn G A 4: 156,172,637 Q1217* probably null Het
Ankrd13c G C 3: 157,947,676 K50N probably benign Het
Anks3 C T 16: 4,957,701 S144N probably damaging Het
Apob A T 12: 8,009,054 D2512V probably damaging Het
Arhgap45 A G 10: 80,027,860 K815E probably damaging Het
Atr T A 9: 95,865,045 C127S probably benign Het
B4galnt4 A G 7: 141,068,662 D697G probably damaging Het
C2cd3 C T 7: 100,380,042 L134F probably damaging Het
Celsr2 C T 3: 108,401,599 G1697D probably damaging Het
Cep170 A G 1: 176,756,255 S88P possibly damaging Het
Cnot1 A G 8: 95,729,246 V1961A probably damaging Het
Cntnap4 A G 8: 112,841,717 N795S probably damaging Het
Cog2 T A 8: 124,533,386 V256D possibly damaging Het
Col14a1 A G 15: 55,519,149 Y515C Het
Cox7a1 A G 7: 30,185,158 Q30R probably damaging Het
Cs T C 10: 128,361,016 S427P probably damaging Het
D17Wsu92e A T 17: 27,793,939 F95I probably damaging Het
Dbr1 T A 9: 99,582,470 C101S Het
Dhcr7 C A 7: 143,847,475 Y461* probably null Het
Dis3l2 T A 1: 87,047,062 M691K probably benign Het
Dnah17 T C 11: 118,088,978 D1751G probably damaging Het
Dock10 A T 1: 80,503,672 I536K Het
Dok6 G T 18: 89,473,864 F196L possibly damaging Het
Epx C T 11: 87,864,825 D678N probably damaging Het
Fcrlb G C 1: 170,912,166 P56A probably benign Het
Flrt3 T C 2: 140,660,896 R271G possibly damaging Het
Galnt15 T A 14: 32,052,344 L479Q probably damaging Het
Gfy G A 7: 45,178,361 L104F probably benign Het
Gltp C T 5: 114,676,321 M80I probably benign Het
Gm21560 G A 14: 6,218,250 T76I probably benign Het
Gm5150 A G 3: 15,990,665 I132T probably benign Het
Hdac9 T C 12: 34,389,390 H437R probably damaging Het
Hpgd C A 8: 56,298,384 F82L Het
Ifi207 GAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGACTATTGGATGGTGTTGATAGAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGAT GAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGACTATTGGATGGTGTTGATAGAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGAT 1: 173,728,995 probably benign Het
Jakmip3 G A 7: 139,023,389 probably null Het
Kctd1 A T 18: 15,063,554 M4K unknown Het
Kirrel C A 3: 87,095,718 E123* probably null Het
Krt83 G C 15: 101,491,167 P95A probably benign Het
Man1a A T 10: 53,920,062 H511Q probably damaging Het
Megf8 A G 7: 25,343,769 D1372G possibly damaging Het
Mrgprd A G 7: 145,321,452 D20G probably benign Het
Mrpl54 C T 10: 81,265,694 G78S probably damaging Het
Myl1 T A 1: 66,930,289 E61D probably benign Het
Myo7a G T 7: 98,063,730 H1679Q probably benign Het
Naca A G 10: 128,042,357 E1086G unknown Het
Nagpa C G 16: 5,199,965 D258H probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nr2f6 G A 8: 71,374,527 L377F probably damaging Het
Ntsr1 G A 2: 180,541,481 R328H probably damaging Het
Nup93 G A 8: 94,306,639 S592N probably damaging Het
Olfr1286 T A 2: 111,420,792 H53L probably benign Het
Olfr714 A T 7: 107,073,957 N43I probably damaging Het
Olfr957 T C 9: 39,511,201 D173G probably benign Het
Pard3 T C 8: 127,409,672 V842A possibly damaging Het
Phospho2 T A 2: 69,795,951 N150K probably damaging Het
Piwil1 T C 5: 128,753,987 S791P probably damaging Het
Pkhd1 A G 1: 20,392,213 V2039A possibly damaging Het
Ppp1r3c A G 19: 36,734,004 I122T probably benign Het
Prrc2c A G 1: 162,692,390 Y2131H possibly damaging Het
Qtrt2 T C 16: 43,863,177 M311V possibly damaging Het
Rbbp4 T C 4: 129,318,450 D346G probably damaging Het
Slc13a5 A G 11: 72,247,752 I455T probably damaging Het
Slc28a3 A T 13: 58,569,373 Y366* probably null Het
Srgap1 T A 10: 121,869,841 Q226L probably benign Het
Syt17 A G 7: 118,408,156 V362A probably damaging Het
Tas2r117 T C 6: 132,803,411 S171P probably benign Het
Tfap2b A T 1: 19,219,244 I198F probably damaging Het
Tg A T 15: 66,683,738 I760F possibly damaging Het
Tmem123 T C 9: 7,790,983 V95A possibly damaging Het
Tmem198b C A 10: 128,802,517 G59V probably damaging Het
Tmem30c T G 16: 57,276,222 I179L probably benign Het
Tmprss2 A T 16: 97,568,502 D357E probably benign Het
Tns3 G A 11: 8,451,142 T1052M possibly damaging Het
Trex1 A T 9: 109,058,564 C120S probably damaging Het
Ttc8 A G 12: 98,920,706 S13G possibly damaging Het
Ttll7 T C 3: 146,915,732 I362T probably damaging Het
Usp34 A T 11: 23,364,364 T769S Het
Vmn1r185 G T 7: 26,612,014 T22K probably damaging Het
Vmn1r39 T G 6: 66,804,594 M247L probably benign Het
Vmn2r96 A G 17: 18,582,995 D389G probably benign Het
Xirp1 C T 9: 120,017,313 V835I probably benign Het
Ylpm1 T G 12: 84,997,262 I258S unknown Het
Zfp971 A T 2: 178,033,624 S339C probably damaging Het
Other mutations in Itgb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Itgb5 APN 16 33884975 missense probably damaging 1.00
IGL01121:Itgb5 APN 16 33919989 missense probably benign 0.00
IGL01620:Itgb5 APN 16 33919798 missense probably damaging 1.00
IGL02332:Itgb5 APN 16 33920130 nonsense probably null
IGL02869:Itgb5 APN 16 33844992 missense possibly damaging 0.94
IGL02881:Itgb5 APN 16 33919905 missense probably benign 0.00
IGL02941:Itgb5 APN 16 33944095 splice site probably benign
IGL03216:Itgb5 APN 16 33902838 missense probably benign 0.38
IGL03351:Itgb5 APN 16 33910552 missense probably benign 0.00
PIT4812001:Itgb5 UTSW 16 33919987 missense probably damaging 1.00
R0744:Itgb5 UTSW 16 33900583 missense probably damaging 0.99
R0829:Itgb5 UTSW 16 33944201 missense probably benign 0.29
R0836:Itgb5 UTSW 16 33900583 missense probably damaging 0.99
R1387:Itgb5 UTSW 16 33900515 nonsense probably null
R1703:Itgb5 UTSW 16 33910500 missense probably benign 0.01
R1783:Itgb5 UTSW 16 33940562 missense probably benign 0.13
R1826:Itgb5 UTSW 16 33865560 missense possibly damaging 0.48
R1889:Itgb5 UTSW 16 33910469 missense probably damaging 1.00
R2374:Itgb5 UTSW 16 33919798 missense probably damaging 1.00
R4307:Itgb5 UTSW 16 33948732 missense possibly damaging 0.80
R4355:Itgb5 UTSW 16 33844997 missense probably damaging 0.98
R4796:Itgb5 UTSW 16 33885021 missense possibly damaging 0.83
R4879:Itgb5 UTSW 16 33875978 missense probably damaging 1.00
R6165:Itgb5 UTSW 16 33899242 missense probably benign 0.01
R6584:Itgb5 UTSW 16 33885030 missense probably damaging 1.00
R6617:Itgb5 UTSW 16 33946592 missense probably benign 0.01
R6748:Itgb5 UTSW 16 33899297 missense probably damaging 1.00
R6979:Itgb5 UTSW 16 33919986 missense probably damaging 1.00
R7090:Itgb5 UTSW 16 33885094 missense probably damaging 1.00
R7150:Itgb5 UTSW 16 33940643 missense probably benign 0.03
R7403:Itgb5 UTSW 16 33902793 critical splice acceptor site probably null
R7418:Itgb5 UTSW 16 33885094 missense probably damaging 1.00
R7719:Itgb5 UTSW 16 33920116 missense probably benign 0.01
R8309:Itgb5 UTSW 16 33865553 missense probably benign 0.00
R8347:Itgb5 UTSW 16 33940678 missense probably damaging 1.00
R8856:Itgb5 UTSW 16 33900592 missense probably damaging 1.00
R9100:Itgb5 UTSW 16 33920181 missense possibly damaging 0.91
R9194:Itgb5 UTSW 16 33900511 missense probably damaging 1.00
R9309:Itgb5 UTSW 16 33920046 missense probably benign 0.00
R9343:Itgb5 UTSW 16 33910456 splice site probably benign
R9683:Itgb5 UTSW 16 33919965 missense probably damaging 0.97
R9710:Itgb5 UTSW 16 33865547 missense probably benign 0.00
X0022:Itgb5 UTSW 16 33845050 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGCTTCACTGTGGGAAAAGG -3'
(R):5'- GGGTTCCACTTTCCCAGTAC -3'

Sequencing Primer
(F):5'- GGTCTTTGAAATGAGGATCCACC -3'
(R):5'- AGTACTTCATCCCACCATTCCAC -3'
Posted On 2022-09-12