Incidental Mutation 'R0764:Or4a71'
ID 72540
Institutional Source Beutler Lab
Gene Symbol Or4a71
Ensembl Gene ENSMUSG00000075084
Gene Name olfactory receptor family 4 subfamily A member 71
Synonyms Olfr1243, MOR231-4, GA_x6K02T2Q125-50972538-50971621
MMRRC Submission 038944-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R0764 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 89357835-89358752 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 89358340 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 138 (V138A)
Ref Sequence ENSEMBL: ENSMUSP00000149464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099775] [ENSMUST00000144885]
AlphaFold Q8VGM7
Predicted Effect probably benign
Transcript: ENSMUST00000099775
AA Change: V138A

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097363
Gene: ENSMUSG00000075084
AA Change: V138A

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.5e-45 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.2e-5 PFAM
Pfam:7tm_1 39 285 2.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144885
AA Change: V138A

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216635
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.1%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 109,950,772 (GRCm39) Y898N probably damaging Het
Acp4 T C 7: 43,901,738 (GRCm39) probably benign Het
Adipor2 T C 6: 119,334,215 (GRCm39) I332V probably benign Het
Ago3 T A 4: 126,248,885 (GRCm39) K555N possibly damaging Het
Angpt4 A G 2: 151,753,204 (GRCm39) probably benign Het
Ano5 G T 7: 51,187,590 (GRCm39) probably benign Het
Ap3b1 C T 13: 94,616,387 (GRCm39) probably benign Het
Cbl A T 9: 44,075,449 (GRCm39) C399S probably damaging Het
Cdkl2 C A 5: 92,168,136 (GRCm39) V353L probably benign Het
Celsr3 A G 9: 108,705,017 (GRCm39) Y500C probably damaging Het
Cep162 A G 9: 87,083,798 (GRCm39) S1242P probably damaging Het
Crhr1 C T 11: 104,050,152 (GRCm39) R66W probably damaging Het
Ddx49 T C 8: 70,749,907 (GRCm39) E170G probably benign Het
Fam193a T C 5: 34,600,685 (GRCm39) F305L probably damaging Het
Fam76a C T 4: 132,638,010 (GRCm39) G198R probably damaging Het
Gm43302 T A 5: 105,428,355 (GRCm39) I130F probably benign Het
Hectd4 T A 5: 121,424,832 (GRCm39) I745N possibly damaging Het
Ina T A 19: 47,012,087 (GRCm39) *502K probably null Het
Kdm1b A T 13: 47,222,079 (GRCm39) D506V possibly damaging Het
Lrrk2 A G 15: 91,659,249 (GRCm39) probably null Het
Ly6g2 T A 15: 75,092,572 (GRCm39) F97Y probably benign Het
Naip5 A T 13: 100,353,613 (GRCm39) D1215E probably benign Het
Neb A G 2: 52,106,879 (GRCm39) probably benign Het
Nectin2 T A 7: 19,483,096 (GRCm39) probably null Het
Nup155 A T 15: 8,187,244 (GRCm39) H1391L probably damaging Het
Or2aj5 G T 16: 19,425,182 (GRCm39) P79T probably damaging Het
Osbp A G 19: 11,961,520 (GRCm39) probably benign Het
Otog A G 7: 45,949,918 (GRCm39) D2460G probably benign Het
Pcgf1 T C 6: 83,056,150 (GRCm39) C2R probably damaging Het
Per2 C T 1: 91,357,142 (GRCm39) V674M probably damaging Het
Pias3 C T 3: 96,608,611 (GRCm39) P218S probably damaging Het
Plod3 C T 5: 137,018,437 (GRCm39) probably benign Het
Purb C T 11: 6,425,661 (GRCm39) V76M probably damaging Het
Ranbp1 C A 16: 18,058,022 (GRCm39) E181* probably null Het
Rit2 T C 18: 31,286,754 (GRCm39) probably benign Het
Rnf103 C A 6: 71,486,566 (GRCm39) T399K probably damaging Het
Slc22a13 T C 9: 119,037,746 (GRCm39) probably null Het
Slc35f4 T A 14: 49,543,796 (GRCm39) probably benign Het
Sucla2 C T 14: 73,798,074 (GRCm39) probably benign Het
Tnfrsf17 C T 16: 11,133,063 (GRCm39) T47M possibly damaging Het
Tram1 A G 1: 13,649,933 (GRCm39) I97T probably damaging Het
Ttc38 T C 15: 85,730,604 (GRCm39) probably benign Het
Zfp113 T A 5: 138,143,506 (GRCm39) Q248L probably damaging Het
Other mutations in Or4a71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Or4a71 APN 2 89,358,551 (GRCm39) missense probably damaging 1.00
IGL01940:Or4a71 APN 2 89,358,154 (GRCm39) missense probably damaging 0.99
IGL02553:Or4a71 APN 2 89,358,275 (GRCm39) missense probably benign
R0105:Or4a71 UTSW 2 89,358,707 (GRCm39) missense probably benign 0.00
R0105:Or4a71 UTSW 2 89,358,707 (GRCm39) missense probably benign 0.00
R0607:Or4a71 UTSW 2 89,358,451 (GRCm39) missense possibly damaging 0.88
R1779:Or4a71 UTSW 2 89,357,989 (GRCm39) missense probably benign 0.15
R2221:Or4a71 UTSW 2 89,358,281 (GRCm39) missense probably benign 0.05
R3853:Or4a71 UTSW 2 89,357,917 (GRCm39) missense possibly damaging 0.94
R3886:Or4a71 UTSW 2 89,358,076 (GRCm39) missense possibly damaging 0.81
R3887:Or4a71 UTSW 2 89,358,076 (GRCm39) missense possibly damaging 0.81
R3888:Or4a71 UTSW 2 89,358,076 (GRCm39) missense possibly damaging 0.81
R4431:Or4a71 UTSW 2 89,357,987 (GRCm39) missense probably damaging 1.00
R4479:Or4a71 UTSW 2 89,358,514 (GRCm39) missense possibly damaging 0.89
R6807:Or4a71 UTSW 2 89,357,932 (GRCm39) missense probably damaging 1.00
R7025:Or4a71 UTSW 2 89,357,948 (GRCm39) missense probably damaging 0.98
R7094:Or4a71 UTSW 2 89,357,902 (GRCm39) missense probably damaging 1.00
R7144:Or4a71 UTSW 2 89,357,901 (GRCm39) missense probably damaging 1.00
R7972:Or4a71 UTSW 2 89,357,948 (GRCm39) missense probably benign 0.02
R8013:Or4a71 UTSW 2 89,358,280 (GRCm39) missense probably benign 0.05
R9101:Or4a71 UTSW 2 89,358,721 (GRCm39) missense possibly damaging 0.93
R9112:Or4a71 UTSW 2 89,358,337 (GRCm39) missense probably damaging 1.00
R9179:Or4a71 UTSW 2 89,358,494 (GRCm39) nonsense probably null
R9193:Or4a71 UTSW 2 89,357,987 (GRCm39) missense probably damaging 1.00
R9708:Or4a71 UTSW 2 89,358,214 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCAAGGAAGTAGGTGTCAGTGC -3'
(R):5'- CCTACAAAGGTCAATGGGACAGAGC -3'

Sequencing Primer
(F):5'- GCATGCAAGTCCCAGTAATGG -3'
(R):5'- CATTGTGACAATGCTGGGTAACC -3'
Posted On 2013-09-30