Incidental Mutation 'R9630:Kdm5b'
ID 725401
Institutional Source Beutler Lab
Gene Symbol Kdm5b
Ensembl Gene ENSMUSG00000042207
Gene Name lysine (K)-specific demethylase 5B
Synonyms Jarid1b, Plu1, Rb-Bp2, 2210016I17Rik, 2010009J12Rik, PLU-1, D1Ertd202e
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.416) question?
Stock # R9630 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 134560171-134635285 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 134585233 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]
AlphaFold Q80Y84
Predicted Effect probably null
Transcript: ENSMUST00000047714
SMART Domains Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 744 2.2e-17 PFAM
Pfam:PLU-1 757 1088 5.6e-92 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
PHD 1486 1536 1.18e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112198
SMART Domains Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 745 6.7e-21 PFAM
Pfam:PLU-1 756 1088 6e-94 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,137,199 L181P probably damaging Het
Arhgap17 A G 7: 123,308,317 M274T probably benign Het
Bco2 T C 9: 50,545,457 T128A possibly damaging Het
Bcr T A 10: 75,131,118 L519Q probably damaging Het
Cadps2 A T 6: 23,587,572 S306R probably benign Het
Cage1 T C 13: 38,022,879 E330G probably damaging Het
Ccdc8 A G 7: 16,994,808 K74R possibly damaging Het
Cdc42ep2 C A 19: 5,918,335 G114V Het
Celsr3 T C 9: 108,827,097 S260P probably benign Het
Clic4 G A 4: 135,217,165 T233I probably damaging Het
Clip2 C A 5: 134,503,080 D624Y probably damaging Het
Clock A G 5: 76,245,434 S221P probably benign Het
Creb3l2 G T 6: 37,379,873 S86R possibly damaging Het
Cspp1 G A 1: 10,038,067 probably benign Het
Doxl2 A G 6: 48,975,822 D227G probably damaging Het
Dusp13 A T 14: 21,734,906 N128K probably benign Het
Efnb2 T C 8: 8,620,617 S328G probably damaging Het
Egf A G 3: 129,725,195 L335P possibly damaging Het
Eml4 T A 17: 83,410,143 V48D probably damaging Het
Fat2 A C 11: 55,256,779 V3879G probably benign Het
Flnb T A 14: 7,926,438 Y1827* probably null Het
Fuca2 A T 10: 13,503,076 Y71F probably benign Het
Gcn1l1 C A 5: 115,603,290 H1463N probably damaging Het
Ifitm10 C T 7: 142,371,172 A48T probably damaging Het
Iqce T C 5: 140,680,836 D385G possibly damaging Het
Kdm7a A T 6: 39,173,305 S178T probably damaging Het
Mmp12 T A 9: 7,347,516 M31K probably benign Het
Mon2 C T 10: 123,038,510 R311H probably damaging Het
Myh15 A G 16: 49,159,978 T1488A probably benign Het
Myo15 T A 11: 60,517,162 C3159S probably damaging Het
Nf1 T C 11: 79,411,644 V346A probably damaging Het
Nfkbib A T 7: 28,761,879 Y114* probably null Het
Nr2c1 T A 10: 94,162,423 D76E probably benign Het
Obscn G A 11: 59,052,571 R4251C probably benign Het
Olfr1022 A G 2: 85,869,149 M186V probably benign Het
Olfr1097 A C 2: 86,890,612 S188A probably damaging Het
Olfr1247 C A 2: 89,610,005 M32I probably benign Het
Olfr356 T C 2: 36,937,641 I174T probably damaging Het
Olfr820 T C 10: 130,017,541 F60S probably damaging Het
Pced1a A T 2: 130,419,189 I416N probably benign Het
Pdzd2 G T 15: 12,374,357 D1897E probably benign Het
Pign A T 1: 105,553,866 F802I probably benign Het
Pik3c2g C A 6: 139,622,239 Q118K possibly damaging Het
Plcl2 A G 17: 50,640,119 M1009V probably benign Het
Ppil6 T A 10: 41,494,554 D59E probably benign Het
Rad23a T C 8: 84,838,290 D152G probably benign Het
Rif1 A G 2: 52,089,595 I430V probably damaging Het
Rint1 T C 5: 23,815,812 V611A possibly damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sall4 A G 2: 168,754,488 S811P probably benign Het
Scaf11 G A 15: 96,418,168 P1172S probably damaging Het
Sel1l3 T G 5: 53,184,775 N368H possibly damaging Het
Sele C A 1: 164,051,954 P352Q probably damaging Het
Serpinf1 T A 11: 75,411,026 T268S probably benign Het
Sez6 G A 11: 77,974,295 E623K possibly damaging Het
Sis A T 3: 72,921,389 N1152K probably benign Het
Slc16a13 T C 11: 70,217,771 E411G possibly damaging Het
Slc22a23 T C 13: 34,195,407 N459S possibly damaging Het
Srpk1 C A 17: 28,600,430 K268N probably benign Het
Ssbp3 A G 4: 107,038,229 Y258C probably damaging Het
Ssc5d C T 7: 4,936,427 P621S probably damaging Het
Strada T C 11: 106,186,955 Q61R unknown Het
Strn3 G A 12: 51,610,230 T755I probably damaging Het
Taf4b C G 18: 14,797,020 P150A probably damaging Het
Tmem236 T A 2: 14,219,004 H201Q probably benign Het
Top3b A G 16: 16,892,490 E728G probably benign Het
Tshr C T 12: 91,537,635 P449L probably damaging Het
Ugt2b36 C T 5: 87,091,914 G204D possibly damaging Het
Vldlr A T 19: 27,230,223 Q37L probably damaging Het
Zfat A T 15: 68,118,944 I1031N probably benign Het
Other mutations in Kdm5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kdm5b APN 1 134620955 missense probably damaging 1.00
IGL01458:Kdm5b APN 1 134621986 missense possibly damaging 0.53
IGL01567:Kdm5b APN 1 134602540 missense probably damaging 1.00
IGL01625:Kdm5b APN 1 134617968 missense possibly damaging 0.74
IGL01970:Kdm5b APN 1 134600727 missense probably damaging 1.00
IGL02183:Kdm5b APN 1 134624931 missense probably benign 0.09
IGL02592:Kdm5b APN 1 134624853 missense probably damaging 0.99
IGL02695:Kdm5b APN 1 134604485 missense possibly damaging 0.94
IGL02697:Kdm5b APN 1 134588773 splice site probably benign
IGL03036:Kdm5b APN 1 134608937 missense probably damaging 1.00
IGL03056:Kdm5b APN 1 134587979 missense probably damaging 0.99
IGL03206:Kdm5b APN 1 134627317 missense probably benign
IGL03342:Kdm5b APN 1 134602576 missense probably benign 0.00
IGL03388:Kdm5b APN 1 134627322 missense probably benign
amaryllis UTSW 1 134609061 critical splice donor site probably null
PIT4486001:Kdm5b UTSW 1 134628685 missense probably damaging 1.00
R0233:Kdm5b UTSW 1 134604634 splice site probably benign
R0334:Kdm5b UTSW 1 134604522 missense probably damaging 0.99
R0504:Kdm5b UTSW 1 134621023 critical splice donor site probably null
R0505:Kdm5b UTSW 1 134602571 missense probably damaging 0.96
R0521:Kdm5b UTSW 1 134618033 missense possibly damaging 0.65
R1004:Kdm5b UTSW 1 134588904 missense possibly damaging 0.71
R1087:Kdm5b UTSW 1 134600637 missense probably damaging 1.00
R1126:Kdm5b UTSW 1 134613991 missense possibly damaging 0.90
R1221:Kdm5b UTSW 1 134599091 missense probably damaging 0.98
R1230:Kdm5b UTSW 1 134613254 missense probably damaging 1.00
R1345:Kdm5b UTSW 1 134630550 missense possibly damaging 0.94
R1482:Kdm5b UTSW 1 134624897 missense probably damaging 1.00
R1582:Kdm5b UTSW 1 134624853 missense probably damaging 0.99
R1653:Kdm5b UTSW 1 134602481 missense probably damaging 1.00
R1693:Kdm5b UTSW 1 134597576 splice site probably benign
R1721:Kdm5b UTSW 1 134613181 splice site probably benign
R1741:Kdm5b UTSW 1 134618017 missense possibly damaging 0.82
R1762:Kdm5b UTSW 1 134604467 nonsense probably null
R1820:Kdm5b UTSW 1 134597670 missense possibly damaging 0.87
R1872:Kdm5b UTSW 1 134624994 missense probably damaging 1.00
R1966:Kdm5b UTSW 1 134613873 splice site probably null
R2056:Kdm5b UTSW 1 134613214 missense probably benign 0.05
R2059:Kdm5b UTSW 1 134613214 missense probably benign 0.05
R2405:Kdm5b UTSW 1 134609016 missense probably damaging 0.97
R3417:Kdm5b UTSW 1 134587977 missense probably damaging 1.00
R3771:Kdm5b UTSW 1 134613345 missense probably damaging 1.00
R3783:Kdm5b UTSW 1 134630542 missense probably benign
R3803:Kdm5b UTSW 1 134615941 missense probably benign 0.07
R3980:Kdm5b UTSW 1 134619670 missense probably benign 0.11
R3983:Kdm5b UTSW 1 134631304 missense possibly damaging 0.91
R4013:Kdm5b UTSW 1 134627329 missense possibly damaging 0.86
R4162:Kdm5b UTSW 1 134625161 missense probably benign 0.01
R4701:Kdm5b UTSW 1 134606012 intron probably benign
R4791:Kdm5b UTSW 1 134630800 missense possibly damaging 0.82
R4836:Kdm5b UTSW 1 134593315 splice site probably null
R4924:Kdm5b UTSW 1 134631351 missense probably benign 0.00
R5135:Kdm5b UTSW 1 134588746 intron probably benign
R5248:Kdm5b UTSW 1 134620997 missense probably benign 0.11
R5290:Kdm5b UTSW 1 134622099 splice site probably null
R5358:Kdm5b UTSW 1 134607694 nonsense probably null
R5388:Kdm5b UTSW 1 134608897 nonsense probably null
R5396:Kdm5b UTSW 1 134622098 splice site probably null
R5397:Kdm5b UTSW 1 134622098 splice site probably null
R5398:Kdm5b UTSW 1 134622098 splice site probably null
R5399:Kdm5b UTSW 1 134622098 splice site probably null
R5529:Kdm5b UTSW 1 134588003 missense probably damaging 1.00
R5540:Kdm5b UTSW 1 134631241 missense probably damaging 0.98
R5661:Kdm5b UTSW 1 134599073 missense probably benign 0.01
R5663:Kdm5b UTSW 1 134630635 missense probably benign
R5822:Kdm5b UTSW 1 134588773 splice site probably benign
R6226:Kdm5b UTSW 1 134608878 missense probably damaging 0.99
R6368:Kdm5b UTSW 1 134599207 missense probably damaging 1.00
R6681:Kdm5b UTSW 1 134613269 missense possibly damaging 0.90
R6715:Kdm5b UTSW 1 134609061 critical splice donor site probably null
R7132:Kdm5b UTSW 1 134599106 missense probably damaging 1.00
R7202:Kdm5b UTSW 1 134624759 missense probably benign
R7258:Kdm5b UTSW 1 134621021 missense probably damaging 1.00
R7335:Kdm5b UTSW 1 134560439 missense probably damaging 1.00
R7420:Kdm5b UTSW 1 134604497 missense probably benign 0.14
R7426:Kdm5b UTSW 1 134595833 missense probably benign 0.02
R7452:Kdm5b UTSW 1 134624948 missense probably damaging 1.00
R7595:Kdm5b UTSW 1 134608966 missense probably benign 0.00
R7612:Kdm5b UTSW 1 134624918 nonsense probably null
R7704:Kdm5b UTSW 1 134587931 missense probably damaging 1.00
R7846:Kdm5b UTSW 1 134617840 missense probably damaging 1.00
R8115:Kdm5b UTSW 1 134619673 missense possibly damaging 0.83
R8146:Kdm5b UTSW 1 134625126 missense probably benign 0.05
R8160:Kdm5b UTSW 1 134613919 missense probably damaging 1.00
R8527:Kdm5b UTSW 1 134605774 missense possibly damaging 0.78
R8542:Kdm5b UTSW 1 134605774 missense possibly damaging 0.78
R8930:Kdm5b UTSW 1 134616272 missense probably damaging 1.00
R8932:Kdm5b UTSW 1 134616272 missense probably damaging 1.00
R8950:Kdm5b UTSW 1 134613926 missense possibly damaging 0.84
R9089:Kdm5b UTSW 1 134607768 missense probably damaging 0.98
R9109:Kdm5b UTSW 1 134600755 critical splice donor site probably null
R9133:Kdm5b UTSW 1 134602585 missense probably benign
R9298:Kdm5b UTSW 1 134600755 critical splice donor site probably null
R9423:Kdm5b UTSW 1 134587967 missense possibly damaging 0.85
R9670:Kdm5b UTSW 1 134630502 nonsense probably null
X0063:Kdm5b UTSW 1 134588876 missense probably benign 0.07
Z1176:Kdm5b UTSW 1 134625035 missense probably damaging 1.00
Z1177:Kdm5b UTSW 1 134595798 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATGCCGGATGTACCAGTGTC -3'
(R):5'- TGTATTACTTAGCAGACAAGAGGAGAC -3'

Sequencing Primer
(F):5'- TTTCTTGTAGAAAACTGCACCACTC -3'
(R):5'- CAGACAAGAGGAGACAGACATAAGTC -3'
Posted On 2022-09-12