Incidental Mutation 'R9630:Kdm5b'
ID 725401
Institutional Source Beutler Lab
Gene Symbol Kdm5b
Ensembl Gene ENSMUSG00000042207
Gene Name lysine demethylase 5B
Synonyms 2010009J12Rik, PLU-1, Rb-Bp2, Jarid1b, D1Ertd202e, Plu1, 2210016I17Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.356) question?
Stock # R9630 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 134487916-134560621 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 134512971 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]
AlphaFold Q80Y84
Predicted Effect probably null
Transcript: ENSMUST00000047714
SMART Domains Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 744 2.2e-17 PFAM
Pfam:PLU-1 757 1088 5.6e-92 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
PHD 1486 1536 1.18e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112198
SMART Domains Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 745 6.7e-21 PFAM
Pfam:PLU-1 756 1088 6e-94 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc1l1 A G 6: 48,952,756 (GRCm39) D227G probably damaging Het
Arhgap17 A G 7: 122,907,540 (GRCm39) M274T probably benign Het
Bco2 T C 9: 50,456,757 (GRCm39) T128A possibly damaging Het
Bcr T A 10: 74,966,950 (GRCm39) L519Q probably damaging Het
Cadps2 A T 6: 23,587,571 (GRCm39) S306R probably benign Het
Cage1 T C 13: 38,206,855 (GRCm39) E330G probably damaging Het
Ccdc8 A G 7: 16,728,733 (GRCm39) K74R possibly damaging Het
Cdc42ep2 C A 19: 5,968,363 (GRCm39) G114V Het
Celsr3 T C 9: 108,704,296 (GRCm39) S260P probably benign Het
Clic4 G A 4: 134,944,476 (GRCm39) T233I probably damaging Het
Clip2 C A 5: 134,531,934 (GRCm39) D624Y probably damaging Het
Clock A G 5: 76,393,281 (GRCm39) S221P probably benign Het
Creb3l2 G T 6: 37,356,808 (GRCm39) S86R possibly damaging Het
Cspp1 G A 1: 10,108,292 (GRCm39) probably benign Het
Dusp13b A T 14: 21,784,974 (GRCm39) N128K probably benign Het
Efnb2 T C 8: 8,670,617 (GRCm39) S328G probably damaging Het
Egf A G 3: 129,518,844 (GRCm39) L335P possibly damaging Het
Eml4 T A 17: 83,717,572 (GRCm39) V48D probably damaging Het
Fat2 A C 11: 55,147,605 (GRCm39) V3879G probably benign Het
Fcgbpl1 T C 7: 27,836,624 (GRCm39) L181P probably damaging Het
Flnb T A 14: 7,926,438 (GRCm38) Y1827* probably null Het
Fuca2 A T 10: 13,378,820 (GRCm39) Y71F probably benign Het
Gcn1 C A 5: 115,741,349 (GRCm39) H1463N probably damaging Het
Ifitm10 C T 7: 141,924,909 (GRCm39) A48T probably damaging Het
Iqce T C 5: 140,666,591 (GRCm39) D385G possibly damaging Het
Kdm7a A T 6: 39,150,239 (GRCm39) S178T probably damaging Het
Mmp12 T A 9: 7,347,516 (GRCm39) M31K probably benign Het
Mon2 C T 10: 122,874,415 (GRCm39) R311H probably damaging Het
Myh15 A G 16: 48,980,341 (GRCm39) T1488A probably benign Het
Myo15a T A 11: 60,407,988 (GRCm39) C3159S probably damaging Het
Nf1 T C 11: 79,302,470 (GRCm39) V346A probably damaging Het
Nfkbib A T 7: 28,461,304 (GRCm39) Y114* probably null Het
Nr2c1 T A 10: 93,998,285 (GRCm39) D76E probably benign Het
Obscn G A 11: 58,943,397 (GRCm39) R4251C probably benign Het
Or1ak2 T C 2: 36,827,653 (GRCm39) I174T probably damaging Het
Or4a74 C A 2: 89,440,349 (GRCm39) M32I probably benign Het
Or5m10b A G 2: 85,699,493 (GRCm39) M186V probably benign Het
Or6c33 T C 10: 129,853,410 (GRCm39) F60S probably damaging Het
Or8h7 A C 2: 86,720,956 (GRCm39) S188A probably damaging Het
Pced1a A T 2: 130,261,109 (GRCm39) I416N probably benign Het
Pdzd2 G T 15: 12,374,443 (GRCm39) D1897E probably benign Het
Pign A T 1: 105,481,591 (GRCm39) F802I probably benign Het
Pik3c2g C A 6: 139,599,237 (GRCm39) Q118K possibly damaging Het
Plcl2 A G 17: 50,947,147 (GRCm39) M1009V probably benign Het
Ppil6 T A 10: 41,370,550 (GRCm39) D59E probably benign Het
Rad23a T C 8: 85,564,919 (GRCm39) D152G probably benign Het
Rif1 A G 2: 51,979,607 (GRCm39) I430V probably damaging Het
Rint1 T C 5: 24,020,810 (GRCm39) V611A possibly damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,229,113 (GRCm39) probably benign Het
Sall4 A G 2: 168,596,408 (GRCm39) S811P probably benign Het
Scaf11 G A 15: 96,316,049 (GRCm39) P1172S probably damaging Het
Sel1l3 T G 5: 53,342,117 (GRCm39) N368H possibly damaging Het
Sele C A 1: 163,879,523 (GRCm39) P352Q probably damaging Het
Serpinf1 T A 11: 75,301,852 (GRCm39) T268S probably benign Het
Sez6 G A 11: 77,865,121 (GRCm39) E623K possibly damaging Het
Sis A T 3: 72,828,722 (GRCm39) N1152K probably benign Het
Slc16a13 T C 11: 70,108,597 (GRCm39) E411G possibly damaging Het
Slc22a23 T C 13: 34,379,390 (GRCm39) N459S possibly damaging Het
Srpk1 C A 17: 28,819,404 (GRCm39) K268N probably benign Het
Ssbp3 A G 4: 106,895,426 (GRCm39) Y258C probably damaging Het
Ssc5d C T 7: 4,939,426 (GRCm39) P621S probably damaging Het
Strada T C 11: 106,077,781 (GRCm39) Q61R unknown Het
Strn3 G A 12: 51,657,013 (GRCm39) T755I probably damaging Het
Taf4b C G 18: 14,930,077 (GRCm39) P150A probably damaging Het
Tmem236 T A 2: 14,223,815 (GRCm39) H201Q probably benign Het
Top3b A G 16: 16,710,354 (GRCm39) E728G probably benign Het
Tshr C T 12: 91,504,409 (GRCm39) P449L probably damaging Het
Ugt2b36 C T 5: 87,239,773 (GRCm39) G204D possibly damaging Het
Vldlr A T 19: 27,207,623 (GRCm39) Q37L probably damaging Het
Zfat A T 15: 67,990,793 (GRCm39) I1031N probably benign Het
Other mutations in Kdm5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kdm5b APN 1 134,548,693 (GRCm39) missense probably damaging 1.00
IGL01458:Kdm5b APN 1 134,549,724 (GRCm39) missense possibly damaging 0.53
IGL01567:Kdm5b APN 1 134,530,278 (GRCm39) missense probably damaging 1.00
IGL01625:Kdm5b APN 1 134,545,706 (GRCm39) missense possibly damaging 0.74
IGL01970:Kdm5b APN 1 134,528,465 (GRCm39) missense probably damaging 1.00
IGL02183:Kdm5b APN 1 134,552,669 (GRCm39) missense probably benign 0.09
IGL02592:Kdm5b APN 1 134,552,591 (GRCm39) missense probably damaging 0.99
IGL02695:Kdm5b APN 1 134,532,223 (GRCm39) missense possibly damaging 0.94
IGL02697:Kdm5b APN 1 134,516,511 (GRCm39) splice site probably benign
IGL03036:Kdm5b APN 1 134,536,675 (GRCm39) missense probably damaging 1.00
IGL03056:Kdm5b APN 1 134,515,717 (GRCm39) missense probably damaging 0.99
IGL03206:Kdm5b APN 1 134,555,055 (GRCm39) missense probably benign
IGL03342:Kdm5b APN 1 134,530,314 (GRCm39) missense probably benign 0.00
IGL03388:Kdm5b APN 1 134,555,060 (GRCm39) missense probably benign
amaryllis UTSW 1 134,536,799 (GRCm39) critical splice donor site probably null
PIT4486001:Kdm5b UTSW 1 134,556,423 (GRCm39) missense probably damaging 1.00
R0233:Kdm5b UTSW 1 134,532,372 (GRCm39) splice site probably benign
R0334:Kdm5b UTSW 1 134,532,260 (GRCm39) missense probably damaging 0.99
R0504:Kdm5b UTSW 1 134,548,761 (GRCm39) critical splice donor site probably null
R0505:Kdm5b UTSW 1 134,530,309 (GRCm39) missense probably damaging 0.96
R0521:Kdm5b UTSW 1 134,545,771 (GRCm39) missense possibly damaging 0.65
R1004:Kdm5b UTSW 1 134,516,642 (GRCm39) missense possibly damaging 0.71
R1087:Kdm5b UTSW 1 134,528,375 (GRCm39) missense probably damaging 1.00
R1126:Kdm5b UTSW 1 134,541,729 (GRCm39) missense possibly damaging 0.90
R1221:Kdm5b UTSW 1 134,526,829 (GRCm39) missense probably damaging 0.98
R1230:Kdm5b UTSW 1 134,540,992 (GRCm39) missense probably damaging 1.00
R1345:Kdm5b UTSW 1 134,558,288 (GRCm39) missense possibly damaging 0.94
R1482:Kdm5b UTSW 1 134,552,635 (GRCm39) missense probably damaging 1.00
R1582:Kdm5b UTSW 1 134,552,591 (GRCm39) missense probably damaging 0.99
R1653:Kdm5b UTSW 1 134,530,219 (GRCm39) missense probably damaging 1.00
R1693:Kdm5b UTSW 1 134,525,314 (GRCm39) splice site probably benign
R1721:Kdm5b UTSW 1 134,540,919 (GRCm39) splice site probably benign
R1741:Kdm5b UTSW 1 134,545,755 (GRCm39) missense possibly damaging 0.82
R1762:Kdm5b UTSW 1 134,532,205 (GRCm39) nonsense probably null
R1820:Kdm5b UTSW 1 134,525,408 (GRCm39) missense possibly damaging 0.87
R1872:Kdm5b UTSW 1 134,552,732 (GRCm39) missense probably damaging 1.00
R1966:Kdm5b UTSW 1 134,541,611 (GRCm39) splice site probably null
R2056:Kdm5b UTSW 1 134,540,952 (GRCm39) missense probably benign 0.05
R2059:Kdm5b UTSW 1 134,540,952 (GRCm39) missense probably benign 0.05
R2405:Kdm5b UTSW 1 134,536,754 (GRCm39) missense probably damaging 0.97
R3417:Kdm5b UTSW 1 134,515,715 (GRCm39) missense probably damaging 1.00
R3771:Kdm5b UTSW 1 134,541,083 (GRCm39) missense probably damaging 1.00
R3783:Kdm5b UTSW 1 134,558,280 (GRCm39) missense probably benign
R3803:Kdm5b UTSW 1 134,543,679 (GRCm39) missense probably benign 0.07
R3980:Kdm5b UTSW 1 134,547,408 (GRCm39) missense probably benign 0.11
R3983:Kdm5b UTSW 1 134,559,042 (GRCm39) missense possibly damaging 0.91
R4013:Kdm5b UTSW 1 134,555,067 (GRCm39) missense possibly damaging 0.86
R4162:Kdm5b UTSW 1 134,552,899 (GRCm39) missense probably benign 0.01
R4701:Kdm5b UTSW 1 134,533,750 (GRCm39) intron probably benign
R4791:Kdm5b UTSW 1 134,558,538 (GRCm39) missense possibly damaging 0.82
R4836:Kdm5b UTSW 1 134,521,053 (GRCm39) splice site probably null
R4924:Kdm5b UTSW 1 134,559,089 (GRCm39) missense probably benign 0.00
R5135:Kdm5b UTSW 1 134,516,484 (GRCm39) intron probably benign
R5248:Kdm5b UTSW 1 134,548,735 (GRCm39) missense probably benign 0.11
R5290:Kdm5b UTSW 1 134,549,837 (GRCm39) splice site probably null
R5358:Kdm5b UTSW 1 134,535,432 (GRCm39) nonsense probably null
R5388:Kdm5b UTSW 1 134,536,635 (GRCm39) nonsense probably null
R5396:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5397:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5398:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5399:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5529:Kdm5b UTSW 1 134,515,741 (GRCm39) missense probably damaging 1.00
R5540:Kdm5b UTSW 1 134,558,979 (GRCm39) missense probably damaging 0.98
R5661:Kdm5b UTSW 1 134,526,811 (GRCm39) missense probably benign 0.01
R5663:Kdm5b UTSW 1 134,558,373 (GRCm39) missense probably benign
R5822:Kdm5b UTSW 1 134,516,511 (GRCm39) splice site probably benign
R6226:Kdm5b UTSW 1 134,536,616 (GRCm39) missense probably damaging 0.99
R6368:Kdm5b UTSW 1 134,526,945 (GRCm39) missense probably damaging 1.00
R6681:Kdm5b UTSW 1 134,541,007 (GRCm39) missense possibly damaging 0.90
R6715:Kdm5b UTSW 1 134,536,799 (GRCm39) critical splice donor site probably null
R7132:Kdm5b UTSW 1 134,526,844 (GRCm39) missense probably damaging 1.00
R7202:Kdm5b UTSW 1 134,552,497 (GRCm39) missense probably benign
R7258:Kdm5b UTSW 1 134,548,759 (GRCm39) missense probably damaging 1.00
R7335:Kdm5b UTSW 1 134,488,177 (GRCm39) missense probably damaging 1.00
R7420:Kdm5b UTSW 1 134,532,235 (GRCm39) missense probably benign 0.14
R7426:Kdm5b UTSW 1 134,523,571 (GRCm39) missense probably benign 0.02
R7452:Kdm5b UTSW 1 134,552,686 (GRCm39) missense probably damaging 1.00
R7595:Kdm5b UTSW 1 134,536,704 (GRCm39) missense probably benign 0.00
R7612:Kdm5b UTSW 1 134,552,656 (GRCm39) nonsense probably null
R7704:Kdm5b UTSW 1 134,515,669 (GRCm39) missense probably damaging 1.00
R7846:Kdm5b UTSW 1 134,545,578 (GRCm39) missense probably damaging 1.00
R8115:Kdm5b UTSW 1 134,547,411 (GRCm39) missense possibly damaging 0.83
R8146:Kdm5b UTSW 1 134,552,864 (GRCm39) missense probably benign 0.05
R8160:Kdm5b UTSW 1 134,541,657 (GRCm39) missense probably damaging 1.00
R8527:Kdm5b UTSW 1 134,533,512 (GRCm39) missense possibly damaging 0.78
R8542:Kdm5b UTSW 1 134,533,512 (GRCm39) missense possibly damaging 0.78
R8930:Kdm5b UTSW 1 134,544,010 (GRCm39) missense probably damaging 1.00
R8932:Kdm5b UTSW 1 134,544,010 (GRCm39) missense probably damaging 1.00
R8950:Kdm5b UTSW 1 134,541,664 (GRCm39) missense possibly damaging 0.84
R9089:Kdm5b UTSW 1 134,535,506 (GRCm39) missense probably damaging 0.98
R9109:Kdm5b UTSW 1 134,528,493 (GRCm39) critical splice donor site probably null
R9133:Kdm5b UTSW 1 134,530,323 (GRCm39) missense probably benign
R9298:Kdm5b UTSW 1 134,528,493 (GRCm39) critical splice donor site probably null
R9423:Kdm5b UTSW 1 134,515,705 (GRCm39) missense possibly damaging 0.85
R9670:Kdm5b UTSW 1 134,558,240 (GRCm39) nonsense probably null
X0063:Kdm5b UTSW 1 134,516,614 (GRCm39) missense probably benign 0.07
Z1176:Kdm5b UTSW 1 134,552,773 (GRCm39) missense probably damaging 1.00
Z1177:Kdm5b UTSW 1 134,523,536 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATGCCGGATGTACCAGTGTC -3'
(R):5'- TGTATTACTTAGCAGACAAGAGGAGAC -3'

Sequencing Primer
(F):5'- TTTCTTGTAGAAAACTGCACCACTC -3'
(R):5'- CAGACAAGAGGAGACAGACATAAGTC -3'
Posted On 2022-09-12