Incidental Mutation 'R0764:Fam76a'
ID 72542
Institutional Source Beutler Lab
Gene Symbol Fam76a
Ensembl Gene ENSMUSG00000028878
Gene Name family with sequence similarity 76, member A
Synonyms
MMRRC Submission 038944-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.208) question?
Stock # R0764 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 132626524-132649869 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 132638010 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 198 (G198R)
Ref Sequence ENSEMBL: ENSMUSP00000030696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030696] [ENSMUST00000097856] [ENSMUST00000148667]
AlphaFold Q922G2
Predicted Effect probably damaging
Transcript: ENSMUST00000030696
AA Change: G198R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030696
Gene: ENSMUSG00000028878
AA Change: G198R

DomainStartEndE-ValueType
Pfam:FAM76 4 297 2.3e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097856
SMART Domains Protein: ENSMUSP00000095468
Gene: ENSMUSG00000028878

DomainStartEndE-ValueType
low complexity region 111 122 N/A INTRINSIC
coiled coil region 188 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148667
SMART Domains Protein: ENSMUSP00000121892
Gene: ENSMUSG00000028878

DomainStartEndE-ValueType
internal_repeat_1 38 63 9.63e-5 PROSPERO
internal_repeat_1 68 93 9.63e-5 PROSPERO
low complexity region 94 105 N/A INTRINSIC
Meta Mutation Damage Score 0.4288 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.1%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 109,950,772 (GRCm39) Y898N probably damaging Het
Acp4 T C 7: 43,901,738 (GRCm39) probably benign Het
Adipor2 T C 6: 119,334,215 (GRCm39) I332V probably benign Het
Ago3 T A 4: 126,248,885 (GRCm39) K555N possibly damaging Het
Angpt4 A G 2: 151,753,204 (GRCm39) probably benign Het
Ano5 G T 7: 51,187,590 (GRCm39) probably benign Het
Ap3b1 C T 13: 94,616,387 (GRCm39) probably benign Het
Cbl A T 9: 44,075,449 (GRCm39) C399S probably damaging Het
Cdkl2 C A 5: 92,168,136 (GRCm39) V353L probably benign Het
Celsr3 A G 9: 108,705,017 (GRCm39) Y500C probably damaging Het
Cep162 A G 9: 87,083,798 (GRCm39) S1242P probably damaging Het
Crhr1 C T 11: 104,050,152 (GRCm39) R66W probably damaging Het
Ddx49 T C 8: 70,749,907 (GRCm39) E170G probably benign Het
Fam193a T C 5: 34,600,685 (GRCm39) F305L probably damaging Het
Gm43302 T A 5: 105,428,355 (GRCm39) I130F probably benign Het
Hectd4 T A 5: 121,424,832 (GRCm39) I745N possibly damaging Het
Ina T A 19: 47,012,087 (GRCm39) *502K probably null Het
Kdm1b A T 13: 47,222,079 (GRCm39) D506V possibly damaging Het
Lrrk2 A G 15: 91,659,249 (GRCm39) probably null Het
Ly6g2 T A 15: 75,092,572 (GRCm39) F97Y probably benign Het
Naip5 A T 13: 100,353,613 (GRCm39) D1215E probably benign Het
Neb A G 2: 52,106,879 (GRCm39) probably benign Het
Nectin2 T A 7: 19,483,096 (GRCm39) probably null Het
Nup155 A T 15: 8,187,244 (GRCm39) H1391L probably damaging Het
Or2aj5 G T 16: 19,425,182 (GRCm39) P79T probably damaging Het
Or4a71 A G 2: 89,358,340 (GRCm39) V138A probably benign Het
Osbp A G 19: 11,961,520 (GRCm39) probably benign Het
Otog A G 7: 45,949,918 (GRCm39) D2460G probably benign Het
Pcgf1 T C 6: 83,056,150 (GRCm39) C2R probably damaging Het
Per2 C T 1: 91,357,142 (GRCm39) V674M probably damaging Het
Pias3 C T 3: 96,608,611 (GRCm39) P218S probably damaging Het
Plod3 C T 5: 137,018,437 (GRCm39) probably benign Het
Purb C T 11: 6,425,661 (GRCm39) V76M probably damaging Het
Ranbp1 C A 16: 18,058,022 (GRCm39) E181* probably null Het
Rit2 T C 18: 31,286,754 (GRCm39) probably benign Het
Rnf103 C A 6: 71,486,566 (GRCm39) T399K probably damaging Het
Slc22a13 T C 9: 119,037,746 (GRCm39) probably null Het
Slc35f4 T A 14: 49,543,796 (GRCm39) probably benign Het
Sucla2 C T 14: 73,798,074 (GRCm39) probably benign Het
Tnfrsf17 C T 16: 11,133,063 (GRCm39) T47M possibly damaging Het
Tram1 A G 1: 13,649,933 (GRCm39) I97T probably damaging Het
Ttc38 T C 15: 85,730,604 (GRCm39) probably benign Het
Zfp113 T A 5: 138,143,506 (GRCm39) Q248L probably damaging Het
Other mutations in Fam76a
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB003:Fam76a UTSW 4 132,629,405 (GRCm39) missense probably damaging 1.00
BB013:Fam76a UTSW 4 132,629,405 (GRCm39) missense probably damaging 1.00
R0099:Fam76a UTSW 4 132,638,098 (GRCm39) unclassified probably benign
R1567:Fam76a UTSW 4 132,645,039 (GRCm39) nonsense probably null
R1971:Fam76a UTSW 4 132,631,294 (GRCm39) missense probably damaging 1.00
R3907:Fam76a UTSW 4 132,643,432 (GRCm39) missense probably damaging 1.00
R4571:Fam76a UTSW 4 132,648,208 (GRCm39) missense possibly damaging 0.53
R4783:Fam76a UTSW 4 132,643,501 (GRCm39) missense probably damaging 1.00
R4783:Fam76a UTSW 4 132,629,428 (GRCm39) splice site probably null
R4784:Fam76a UTSW 4 132,643,501 (GRCm39) missense probably damaging 1.00
R4784:Fam76a UTSW 4 132,629,428 (GRCm39) splice site probably null
R4785:Fam76a UTSW 4 132,643,501 (GRCm39) missense probably damaging 1.00
R4785:Fam76a UTSW 4 132,629,428 (GRCm39) splice site probably null
R5871:Fam76a UTSW 4 132,631,321 (GRCm39) missense probably damaging 1.00
R7107:Fam76a UTSW 4 132,631,232 (GRCm39) missense possibly damaging 0.65
R7832:Fam76a UTSW 4 132,629,342 (GRCm39) missense probably damaging 0.99
R7926:Fam76a UTSW 4 132,629,405 (GRCm39) missense probably damaging 1.00
R9430:Fam76a UTSW 4 132,645,055 (GRCm39) missense probably damaging 0.98
R9650:Fam76a UTSW 4 132,629,387 (GRCm39) missense probably damaging 1.00
R9673:Fam76a UTSW 4 132,628,557 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGCACAGCTTATCTACCAACTCTAAGG -3'
(R):5'- AAGTGGACTGACCCTGTGAAACCTC -3'

Sequencing Primer
(F):5'- CTCTAAGGTGACTAGCACAGC -3'
(R):5'- AGTGCATGGAAGAAATTGTTTGTCC -3'
Posted On 2013-09-30