Incidental Mutation 'R9630:Rsf1'
ID 725431
Institutional Source Beutler Lab
Gene Symbol Rsf1
Ensembl Gene ENSMUSG00000035623
Gene Name remodeling and spacing factor 1
Synonyms p325, Hbxap, C030033M12Rik, 4832420A03Rik, XAP8
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9630 (G1)
Quality Score 214.458
Status Not validated
Chromosome 7
Chromosomal Location 97579889-97692778 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) GGCG to GGCGACGGCCGCG at 97579906 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042627] [ENSMUST00000072725] [ENSMUST00000107153] [ENSMUST00000124552] [ENSMUST00000126085] [ENSMUST00000127891] [ENSMUST00000135998] [ENSMUST00000136757] [ENSMUST00000138060] [ENSMUST00000144858] [ENSMUST00000146605] [ENSMUST00000178078] [ENSMUST00000151840] [ENSMUST00000154779] [ENSMUST00000154853]
AlphaFold E9PWW9
Predicted Effect probably benign
Transcript: ENSMUST00000042627
SMART Domains Protein: ENSMUSP00000035883
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 68 115 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072725
SMART Domains Protein: ENSMUSP00000072508
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 68 115 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107153
SMART Domains Protein: ENSMUSP00000102771
Gene: ENSMUSG00000035623

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Pfam:WHIM1 88 138 2.2e-10 PFAM
Pfam:WHIM2 140 172 9.4e-8 PFAM
Pfam:WHIM3 178 398 2.5e-27 PFAM
low complexity region 743 758 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 863 872 N/A INTRINSIC
PHD 881 927 1.57e-11 SMART
low complexity region 945 959 N/A INTRINSIC
low complexity region 971 993 N/A INTRINSIC
low complexity region 1011 1030 N/A INTRINSIC
low complexity region 1072 1096 N/A INTRINSIC
low complexity region 1110 1128 N/A INTRINSIC
low complexity region 1133 1152 N/A INTRINSIC
low complexity region 1160 1190 N/A INTRINSIC
low complexity region 1192 1198 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1268 1280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124552
SMART Domains Protein: ENSMUSP00000120661
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 2 49 8.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126085
SMART Domains Protein: ENSMUSP00000120089
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
SCOP:d1uroa_ 21 60 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127891
Predicted Effect probably benign
Transcript: ENSMUST00000135998
SMART Domains Protein: ENSMUSP00000118391
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 34 128 4.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136757
SMART Domains Protein: ENSMUSP00000121940
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 6 119 2.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138060
SMART Domains Protein: ENSMUSP00000116214
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 40 87 1.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140805
Predicted Effect probably benign
Transcript: ENSMUST00000144858
SMART Domains Protein: ENSMUSP00000117205
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 11 65 3.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146605
SMART Domains Protein: ENSMUSP00000117571
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 23 136 3.4e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205536
Predicted Effect probably benign
Transcript: ENSMUST00000178078
SMART Domains Protein: ENSMUSP00000137067
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 34 147 2.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151840
SMART Domains Protein: ENSMUSP00000115852
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:2Q4Q|B 31 75 5e-23 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000154779
SMART Domains Protein: ENSMUSP00000120195
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
transmembrane domain 30 49 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154853
SMART Domains Protein: ENSMUSP00000115672
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 34 147 9.4e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that interacts with hepatitis B virus X protein (HBX) and facilitates transcription of hepatitis B virus genes by the HBX transcription activator, suggesting a role for this interaction in the virus life cycle. This protein also interacts with SNF2H protein to form the RSF chromatin-remodeling complex, where the SNF2H subunit functions as the nucleosome-dependent ATPase, and this protein as the histone chaperone. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,137,199 L181P probably damaging Het
Arhgap17 A G 7: 123,308,317 M274T probably benign Het
Bco2 T C 9: 50,545,457 T128A possibly damaging Het
Bcr T A 10: 75,131,118 L519Q probably damaging Het
Cadps2 A T 6: 23,587,572 S306R probably benign Het
Cage1 T C 13: 38,022,879 E330G probably damaging Het
Ccdc8 A G 7: 16,994,808 K74R possibly damaging Het
Cdc42ep2 C A 19: 5,918,335 G114V Het
Celsr3 T C 9: 108,827,097 S260P probably benign Het
Clic4 G A 4: 135,217,165 T233I probably damaging Het
Clip2 C A 5: 134,503,080 D624Y probably damaging Het
Clock A G 5: 76,245,434 S221P probably benign Het
Creb3l2 G T 6: 37,379,873 S86R possibly damaging Het
Cspp1 G A 1: 10,038,067 probably benign Het
Doxl2 A G 6: 48,975,822 D227G probably damaging Het
Dusp13 A T 14: 21,734,906 N128K probably benign Het
Efnb2 T C 8: 8,620,617 S328G probably damaging Het
Egf A G 3: 129,725,195 L335P possibly damaging Het
Eml4 T A 17: 83,410,143 V48D probably damaging Het
Fat2 A C 11: 55,256,779 V3879G probably benign Het
Flnb T A 14: 7,926,438 Y1827* probably null Het
Fuca2 A T 10: 13,503,076 Y71F probably benign Het
Gcn1l1 C A 5: 115,603,290 H1463N probably damaging Het
Ifitm10 C T 7: 142,371,172 A48T probably damaging Het
Iqce T C 5: 140,680,836 D385G possibly damaging Het
Kdm5b T A 1: 134,585,233 probably null Het
Kdm7a A T 6: 39,173,305 S178T probably damaging Het
Mmp12 T A 9: 7,347,516 M31K probably benign Het
Mon2 C T 10: 123,038,510 R311H probably damaging Het
Myh15 A G 16: 49,159,978 T1488A probably benign Het
Myo15 T A 11: 60,517,162 C3159S probably damaging Het
Nf1 T C 11: 79,411,644 V346A probably damaging Het
Nfkbib A T 7: 28,761,879 Y114* probably null Het
Nr2c1 T A 10: 94,162,423 D76E probably benign Het
Obscn G A 11: 59,052,571 R4251C probably benign Het
Olfr1022 A G 2: 85,869,149 M186V probably benign Het
Olfr1097 A C 2: 86,890,612 S188A probably damaging Het
Olfr1247 C A 2: 89,610,005 M32I probably benign Het
Olfr356 T C 2: 36,937,641 I174T probably damaging Het
Olfr820 T C 10: 130,017,541 F60S probably damaging Het
Pced1a A T 2: 130,419,189 I416N probably benign Het
Pdzd2 G T 15: 12,374,357 D1897E probably benign Het
Pign A T 1: 105,553,866 F802I probably benign Het
Pik3c2g C A 6: 139,622,239 Q118K possibly damaging Het
Plcl2 A G 17: 50,640,119 M1009V probably benign Het
Ppil6 T A 10: 41,494,554 D59E probably benign Het
Rad23a T C 8: 84,838,290 D152G probably benign Het
Rif1 A G 2: 52,089,595 I430V probably damaging Het
Rint1 T C 5: 23,815,812 V611A possibly damaging Het
Sall4 A G 2: 168,754,488 S811P probably benign Het
Scaf11 G A 15: 96,418,168 P1172S probably damaging Het
Sel1l3 T G 5: 53,184,775 N368H possibly damaging Het
Sele C A 1: 164,051,954 P352Q probably damaging Het
Serpinf1 T A 11: 75,411,026 T268S probably benign Het
Sez6 G A 11: 77,974,295 E623K possibly damaging Het
Sis A T 3: 72,921,389 N1152K probably benign Het
Slc16a13 T C 11: 70,217,771 E411G possibly damaging Het
Slc22a23 T C 13: 34,195,407 N459S possibly damaging Het
Srpk1 C A 17: 28,600,430 K268N probably benign Het
Ssbp3 A G 4: 107,038,229 Y258C probably damaging Het
Ssc5d C T 7: 4,936,427 P621S probably damaging Het
Strada T C 11: 106,186,955 Q61R unknown Het
Strn3 G A 12: 51,610,230 T755I probably damaging Het
Taf4b C G 18: 14,797,020 P150A probably damaging Het
Tmem236 T A 2: 14,219,004 H201Q probably benign Het
Top3b A G 16: 16,892,490 E728G probably benign Het
Tshr C T 12: 91,537,635 P449L probably damaging Het
Ugt2b36 C T 5: 87,091,914 G204D possibly damaging Het
Vldlr A T 19: 27,230,223 Q37L probably damaging Het
Zfat A T 15: 68,118,944 I1031N probably benign Het
Other mutations in Rsf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Rsf1 APN 7 97681889 critical splice donor site probably null 0.00
IGL01160:Rsf1 APN 7 97685584 missense probably damaging 1.00
IGL01780:Rsf1 APN 7 97664770 critical splice donor site probably benign 0.00
IGL01960:Rsf1 APN 7 97661575 missense probably benign 0.00
IGL02487:Rsf1 APN 7 97639491 missense probably damaging 0.99
IGL02814:Rsf1 APN 7 97661227 missense probably damaging 1.00
IGL02972:Rsf1 APN 7 97661326 missense probably benign 0.35
IGL03176:Rsf1 APN 7 97679150 splice site probably benign
IGL03256:Rsf1 APN 7 97679004 missense possibly damaging 0.82
BB011:Rsf1 UTSW 7 97579909 unclassified probably benign
BB014:Rsf1 UTSW 7 97579924 unclassified probably benign
BB018:Rsf1 UTSW 7 97579909 unclassified probably benign
FR4976:Rsf1 UTSW 7 97579909 unclassified probably benign
G1Funyon:Rsf1 UTSW 7 97661925 missense
P0023:Rsf1 UTSW 7 97662271 missense probably damaging 1.00
R0144:Rsf1 UTSW 7 97636407 missense probably damaging 1.00
R0380:Rsf1 UTSW 7 97579905 unclassified probably benign
R0392:Rsf1 UTSW 7 97679005 missense probably benign 0.00
R0422:Rsf1 UTSW 7 97680817 missense probably benign 0.04
R0584:Rsf1 UTSW 7 97662128 missense possibly damaging 0.60
R0636:Rsf1 UTSW 7 97662019 missense possibly damaging 0.74
R0729:Rsf1 UTSW 7 97679027 missense probably damaging 1.00
R0755:Rsf1 UTSW 7 97579967 missense probably damaging 1.00
R0947:Rsf1 UTSW 7 97669778 missense probably damaging 1.00
R1278:Rsf1 UTSW 7 97579904 unclassified probably benign
R1376:Rsf1 UTSW 7 97579907 unclassified probably benign
R1376:Rsf1 UTSW 7 97579907 unclassified probably benign
R1498:Rsf1 UTSW 7 97579907 unclassified probably benign
R1525:Rsf1 UTSW 7 97579908 unclassified probably benign
R1534:Rsf1 UTSW 7 97579909 unclassified probably benign
R1582:Rsf1 UTSW 7 97579908 unclassified probably benign
R1591:Rsf1 UTSW 7 97639313 nonsense probably null
R1676:Rsf1 UTSW 7 97579904 unclassified probably benign
R1695:Rsf1 UTSW 7 97579907 unclassified probably benign
R1710:Rsf1 UTSW 7 97662349 missense possibly damaging 0.50
R1722:Rsf1 UTSW 7 97579908 unclassified probably benign
R1764:Rsf1 UTSW 7 97579908 unclassified probably benign
R1815:Rsf1 UTSW 7 97579906 unclassified probably benign
R1815:Rsf1 UTSW 7 97579907 unclassified probably benign
R1815:Rsf1 UTSW 7 97579908 unclassified probably benign
R1823:Rsf1 UTSW 7 97579910 unclassified probably benign
R1864:Rsf1 UTSW 7 97579904 unclassified probably benign
R1884:Rsf1 UTSW 7 97579910 unclassified probably benign
R1897:Rsf1 UTSW 7 97579910 unclassified probably benign
R1915:Rsf1 UTSW 7 97579907 unclassified probably benign
R1928:Rsf1 UTSW 7 97579909 unclassified probably benign
R1958:Rsf1 UTSW 7 97579908 unclassified probably benign
R1962:Rsf1 UTSW 7 97579906 unclassified probably benign
R1962:Rsf1 UTSW 7 97579907 unclassified probably benign
R1996:Rsf1 UTSW 7 97664632 missense probably damaging 1.00
R1999:Rsf1 UTSW 7 97579908 unclassified probably benign
R2021:Rsf1 UTSW 7 97579906 unclassified probably benign
R2022:Rsf1 UTSW 7 97579910 unclassified probably benign
R2046:Rsf1 UTSW 7 97661677 missense probably benign 0.00
R2048:Rsf1 UTSW 7 97579907 unclassified probably benign
R2093:Rsf1 UTSW 7 97579908 unclassified probably benign
R2103:Rsf1 UTSW 7 97579906 unclassified probably benign
R2137:Rsf1 UTSW 7 97579904 unclassified probably benign
R2167:Rsf1 UTSW 7 97579906 unclassified probably benign
R2179:Rsf1 UTSW 7 97579909 unclassified probably benign
R2191:Rsf1 UTSW 7 97579907 unclassified probably benign
R2207:Rsf1 UTSW 7 97579907 unclassified probably benign
R2211:Rsf1 UTSW 7 97579904 unclassified probably benign
R2241:Rsf1 UTSW 7 97579904 unclassified probably benign
R2264:Rsf1 UTSW 7 97579908 unclassified probably benign
R2283:Rsf1 UTSW 7 97579909 unclassified probably benign
R2297:Rsf1 UTSW 7 97579904 unclassified probably benign
R2307:Rsf1 UTSW 7 97579908 unclassified probably benign
R2419:Rsf1 UTSW 7 97579908 unclassified probably benign
R2442:Rsf1 UTSW 7 97579908 unclassified probably benign
R2696:Rsf1 UTSW 7 97579933 unclassified probably benign
R2764:Rsf1 UTSW 7 97579904 unclassified probably benign
R2939:Rsf1 UTSW 7 97579908 unclassified probably benign
R2965:Rsf1 UTSW 7 97579908 unclassified probably benign
R2972:Rsf1 UTSW 7 97579904 unclassified probably benign
R3008:Rsf1 UTSW 7 97579904 unclassified probably benign
R3013:Rsf1 UTSW 7 97579904 unclassified probably benign
R3026:Rsf1 UTSW 7 97579909 unclassified probably benign
R3110:Rsf1 UTSW 7 97579904 unclassified probably benign
R3147:Rsf1 UTSW 7 97579908 unclassified probably benign
R3427:Rsf1 UTSW 7 97579907 unclassified probably benign
R3610:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R3624:Rsf1 UTSW 7 97579904 unclassified probably benign
R3753:Rsf1 UTSW 7 97662152 missense probably benign 0.00
R3759:Rsf1 UTSW 7 97579909 unclassified probably benign
R3780:Rsf1 UTSW 7 97579904 unclassified probably benign
R3794:Rsf1 UTSW 7 97579904 unclassified probably benign
R3889:Rsf1 UTSW 7 97579906 unclassified probably benign
R3925:Rsf1 UTSW 7 97579907 unclassified probably benign
R3964:Rsf1 UTSW 7 97579907 unclassified probably benign
R4037:Rsf1 UTSW 7 97579904 unclassified probably benign
R4057:Rsf1 UTSW 7 97579906 unclassified probably benign
R4057:Rsf1 UTSW 7 97579907 unclassified probably benign
R4084:Rsf1 UTSW 7 97579919 unclassified probably benign
R4240:Rsf1 UTSW 7 97579935 unclassified probably benign
R4303:Rsf1 UTSW 7 97579920 unclassified probably benign
R4383:Rsf1 UTSW 7 97685476 missense possibly damaging 0.86
R4492:Rsf1 UTSW 7 97579923 unclassified probably benign
R4525:Rsf1 UTSW 7 97579926 unclassified probably benign
R4530:Rsf1 UTSW 7 97579923 unclassified probably benign
R4543:Rsf1 UTSW 7 97579922 unclassified probably benign
R4629:Rsf1 UTSW 7 97579906 unclassified probably benign
R4629:Rsf1 UTSW 7 97579908 unclassified probably benign
R4632:Rsf1 UTSW 7 97579904 unclassified probably benign
R4633:Rsf1 UTSW 7 97579907 unclassified probably benign
R4652:Rsf1 UTSW 7 97579919 unclassified probably benign
R4675:Rsf1 UTSW 7 97579910 unclassified probably benign
R4675:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R4677:Rsf1 UTSW 7 97680773 missense possibly damaging 0.82
R4678:Rsf1 UTSW 7 97579906 unclassified probably benign
R4769:Rsf1 UTSW 7 97676222 missense probably damaging 1.00
R4774:Rsf1 UTSW 7 97579916 unclassified probably benign
R4820:Rsf1 UTSW 7 97579919 unclassified probably benign
R4917:Rsf1 UTSW 7 97662405 missense probably damaging 1.00
R4918:Rsf1 UTSW 7 97662405 missense probably damaging 1.00
R4977:Rsf1 UTSW 7 97579916 unclassified probably benign
R4979:Rsf1 UTSW 7 97579907 unclassified probably benign
R4994:Rsf1 UTSW 7 97579909 unclassified probably benign
R4994:Rsf1 UTSW 7 97579923 unclassified probably benign
R5041:Rsf1 UTSW 7 97579925 unclassified probably benign
R5125:Rsf1 UTSW 7 97661872 missense possibly damaging 0.87
R5178:Rsf1 UTSW 7 97661872 missense possibly damaging 0.87
R5306:Rsf1 UTSW 7 97579929 unclassified probably benign
R5369:Rsf1 UTSW 7 97579904 unclassified probably benign
R5371:Rsf1 UTSW 7 97579913 unclassified probably benign
R5403:Rsf1 UTSW 7 97579907 unclassified probably benign
R5436:Rsf1 UTSW 7 97579931 unclassified probably benign
R5450:Rsf1 UTSW 7 97579908 unclassified probably benign
R5532:Rsf1 UTSW 7 97680695 missense probably damaging 1.00
R5587:Rsf1 UTSW 7 97662121 missense probably benign 0.02
R5657:Rsf1 UTSW 7 97579934 unclassified probably benign
R5689:Rsf1 UTSW 7 97579934 unclassified probably benign
R5745:Rsf1 UTSW 7 97579920 unclassified probably benign
R5748:Rsf1 UTSW 7 97579928 unclassified probably benign
R5773:Rsf1 UTSW 7 97579933 unclassified probably benign
R5859:Rsf1 UTSW 7 97685559 missense probably damaging 1.00
R5938:Rsf1 UTSW 7 97685559 missense probably damaging 1.00
R6001:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6001:Rsf1 UTSW 7 97579907 unclassified probably benign
R6001:Rsf1 UTSW 7 97579910 unclassified probably benign
R6021:Rsf1 UTSW 7 97579909 unclassified probably benign
R6025:Rsf1 UTSW 7 97579908 unclassified probably benign
R6030:Rsf1 UTSW 7 97579906 unclassified probably benign
R6030:Rsf1 UTSW 7 97579906 unclassified probably benign
R6035:Rsf1 UTSW 7 97579904 unclassified probably benign
R6035:Rsf1 UTSW 7 97662109 missense probably benign 0.01
R6035:Rsf1 UTSW 7 97662109 missense probably benign 0.01
R6035:Rsf1 UTSW 7 97579904 unclassified probably benign
R6036:Rsf1 UTSW 7 97579909 unclassified probably benign
R6037:Rsf1 UTSW 7 97579909 unclassified probably benign
R6037:Rsf1 UTSW 7 97579909 unclassified probably benign
R6073:Rsf1 UTSW 7 97579906 unclassified probably benign
R6077:Rsf1 UTSW 7 97579928 unclassified probably benign
R6102:Rsf1 UTSW 7 97579904 unclassified probably benign
R6111:Rsf1 UTSW 7 97579907 unclassified probably benign
R6126:Rsf1 UTSW 7 97579904 unclassified probably benign
R6128:Rsf1 UTSW 7 97579904 unclassified probably benign
R6130:Rsf1 UTSW 7 97579910 unclassified probably benign
R6154:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6154:Rsf1 UTSW 7 97579907 unclassified probably benign
R6165:Rsf1 UTSW 7 97579904 unclassified probably benign
R6166:Rsf1 UTSW 7 97579907 unclassified probably benign
R6182:Rsf1 UTSW 7 97579910 unclassified probably benign
R6189:Rsf1 UTSW 7 97579906 unclassified probably benign
R6200:Rsf1 UTSW 7 97579925 unclassified probably benign
R6210:Rsf1 UTSW 7 97579904 unclassified probably benign
R6212:Rsf1 UTSW 7 97579909 unclassified probably benign
R6214:Rsf1 UTSW 7 97579909 unclassified probably benign
R6215:Rsf1 UTSW 7 97579908 unclassified probably benign
R6216:Rsf1 UTSW 7 97579908 unclassified probably benign
R6232:Rsf1 UTSW 7 97579904 unclassified probably benign
R6235:Rsf1 UTSW 7 97579909 unclassified probably benign
R6242:Rsf1 UTSW 7 97579904 unclassified probably benign
R6243:Rsf1 UTSW 7 97579904 unclassified probably benign
R6244:Rsf1 UTSW 7 97579908 unclassified probably benign
R6268:Rsf1 UTSW 7 97579908 unclassified probably benign
R6269:Rsf1 UTSW 7 97579906 unclassified probably benign
R6273:Rsf1 UTSW 7 97579908 unclassified probably benign
R6275:Rsf1 UTSW 7 97579923 unclassified probably benign
R6286:Rsf1 UTSW 7 97579909 unclassified probably benign
R6291:Rsf1 UTSW 7 97579910 unclassified probably benign
R6293:Rsf1 UTSW 7 97579906 unclassified probably benign
R6297:Rsf1 UTSW 7 97579907 unclassified probably benign
R6302:Rsf1 UTSW 7 97579908 unclassified probably benign
R6309:Rsf1 UTSW 7 97579909 unclassified probably benign
R6312:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6324:Rsf1 UTSW 7 97579908 unclassified probably benign
R6343:Rsf1 UTSW 7 97660917 missense probably benign 0.30
R6346:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6356:Rsf1 UTSW 7 97661934 missense probably benign
R6370:Rsf1 UTSW 7 97579907 unclassified probably benign
R6377:Rsf1 UTSW 7 97579904 unclassified probably benign
R6377:Rsf1 UTSW 7 97579908 unclassified probably benign
R6378:Rsf1 UTSW 7 97579908 unclassified probably benign
R6394:Rsf1 UTSW 7 97579904 unclassified probably benign
R6398:Rsf1 UTSW 7 97579907 unclassified probably benign
R6406:Rsf1 UTSW 7 97579926 unclassified probably benign
R6413:Rsf1 UTSW 7 97579910 unclassified probably benign
R6443:Rsf1 UTSW 7 97579909 unclassified probably benign
R6453:Rsf1 UTSW 7 97579917 unclassified probably benign
R6471:Rsf1 UTSW 7 97579914 unclassified probably benign
R6473:Rsf1 UTSW 7 97579908 unclassified probably benign
R6497:Rsf1 UTSW 7 97579909 unclassified probably benign
R6505:Rsf1 UTSW 7 97579910 unclassified probably benign
R6561:Rsf1 UTSW 7 97579908 unclassified probably benign
R6572:Rsf1 UTSW 7 97579908 unclassified probably benign
R6607:Rsf1 UTSW 7 97579908 unclassified probably benign
R6611:Rsf1 UTSW 7 97579909 unclassified probably benign
R6622:Rsf1 UTSW 7 97579910 unclassified probably benign
R6626:Rsf1 UTSW 7 97579908 unclassified probably benign
R6636:Rsf1 UTSW 7 97579909 unclassified probably benign
R6647:Rsf1 UTSW 7 97579910 unclassified probably benign
R6648:Rsf1 UTSW 7 97579906 unclassified probably benign
R6669:Rsf1 UTSW 7 97579925 unclassified probably benign
R6673:Rsf1 UTSW 7 97579918 unclassified probably benign
R6679:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6685:Rsf1 UTSW 7 97579908 unclassified probably benign
R6694:Rsf1 UTSW 7 97579904 unclassified probably benign
R6694:Rsf1 UTSW 7 97579928 unclassified probably benign
R6695:Rsf1 UTSW 7 97579908 unclassified probably benign
R6697:Rsf1 UTSW 7 97579904 unclassified probably benign
R6726:Rsf1 UTSW 7 97579910 unclassified probably benign
R6739:Rsf1 UTSW 7 97579909 unclassified probably benign
R6747:Rsf1 UTSW 7 97579906 unclassified probably benign
R6751:Rsf1 UTSW 7 97579909 unclassified probably benign
R6771:Rsf1 UTSW 7 97579906 unclassified probably benign
R6773:Rsf1 UTSW 7 97579907 unclassified probably benign
R6787:Rsf1 UTSW 7 97579906 unclassified probably benign
R6800:Rsf1 UTSW 7 97579932 unclassified probably benign
R6804:Rsf1 UTSW 7 97579904 unclassified probably benign
R6806:Rsf1 UTSW 7 97579904 unclassified probably benign
R6815:Rsf1 UTSW 7 97579904 unclassified probably benign
R6820:Rsf1 UTSW 7 97579904 unclassified probably benign
R6823:Rsf1 UTSW 7 97579906 unclassified probably benign
R6829:Rsf1 UTSW 7 97579908 unclassified probably benign
R6861:Rsf1 UTSW 7 97579909 unclassified probably benign
R6862:Rsf1 UTSW 7 97579908 unclassified probably benign
R6869:Rsf1 UTSW 7 97579906 unclassified probably benign
R6875:Rsf1 UTSW 7 97579908 unclassified probably benign
R6889:Rsf1 UTSW 7 97579925 unclassified probably benign
R6897:Rsf1 UTSW 7 97579906 unclassified probably benign
R6960:Rsf1 UTSW 7 97579909 unclassified probably benign
R6963:Rsf1 UTSW 7 97579910 unclassified probably benign
R6967:Rsf1 UTSW 7 97579909 unclassified probably benign
R6969:Rsf1 UTSW 7 97579904 unclassified probably benign
R6977:Rsf1 UTSW 7 97579906 unclassified probably benign
R6996:Rsf1 UTSW 7 97579911 unclassified probably benign
R7066:Rsf1 UTSW 7 97579918 unclassified probably benign
R7109:Rsf1 UTSW 7 97579908 unclassified probably benign
R7127:Rsf1 UTSW 7 97579914 unclassified probably benign
R7138:Rsf1 UTSW 7 97669795 missense
R7214:Rsf1 UTSW 7 97579929 unclassified probably benign
R7217:Rsf1 UTSW 7 97579932 unclassified probably benign
R7238:Rsf1 UTSW 7 97579921 unclassified probably benign
R7246:Rsf1 UTSW 7 97579922 unclassified probably benign
R7253:Rsf1 UTSW 7 97579915 unclassified probably benign
R7294:Rsf1 UTSW 7 97579920 unclassified probably benign
R7305:Rsf1 UTSW 7 97579918 unclassified probably benign
R7309:Rsf1 UTSW 7 97579911 unclassified probably benign
R7352:Rsf1 UTSW 7 97579926 unclassified probably benign
R7380:Rsf1 UTSW 7 97579915 unclassified probably benign
R7393:Rsf1 UTSW 7 97579917 unclassified probably benign
R7395:Rsf1 UTSW 7 97579926 unclassified probably benign
R7411:Rsf1 UTSW 7 97579932 unclassified probably benign
R7413:Rsf1 UTSW 7 97579921 unclassified probably benign
R7481:Rsf1 UTSW 7 97579917 unclassified probably benign
R7538:Rsf1 UTSW 7 97579906 unclassified probably benign
R7541:Rsf1 UTSW 7 97579911 unclassified probably benign
R7545:Rsf1 UTSW 7 97579927 unclassified probably benign
R7574:Rsf1 UTSW 7 97661167 missense
R7578:Rsf1 UTSW 7 97579932 unclassified probably benign
R7599:Rsf1 UTSW 7 97579904 unclassified probably benign
R7630:Rsf1 UTSW 7 97579906 unclassified probably benign
R7632:Rsf1 UTSW 7 97579906 unclassified probably benign
R7710:Rsf1 UTSW 7 97681834 missense
R7711:Rsf1 UTSW 7 97579909 unclassified probably benign
R7715:Rsf1 UTSW 7 97579912 unclassified probably benign
R7719:Rsf1 UTSW 7 97579906 unclassified probably benign
R7722:Rsf1 UTSW 7 97579906 unclassified probably benign
R7729:Rsf1 UTSW 7 97579911 unclassified probably benign
R7734:Rsf1 UTSW 7 97579908 unclassified probably benign
R7743:Rsf1 UTSW 7 97579932 unclassified probably benign
R7761:Rsf1 UTSW 7 97579920 unclassified probably benign
R7764:Rsf1 UTSW 7 97579927 unclassified probably benign
R7797:Rsf1 UTSW 7 97661485 missense
R7802:Rsf1 UTSW 7 97661772 missense
R7806:Rsf1 UTSW 7 97579920 unclassified probably benign
R7821:Rsf1 UTSW 7 97579906 unclassified probably benign
R7823:Rsf1 UTSW 7 97579907 unclassified probably benign
R7824:Rsf1 UTSW 7 97579908 unclassified probably benign
R7825:Rsf1 UTSW 7 97579909 unclassified probably benign
R7826:Rsf1 UTSW 7 97661161 unclassified probably benign
R7841:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R7854:Rsf1 UTSW 7 97579924 unclassified probably benign
R7862:Rsf1 UTSW 7 97579923 unclassified probably benign
R7893:Rsf1 UTSW 7 97661958 missense
R7923:Rsf1 UTSW 7 97579906 unclassified probably benign
R7924:Rsf1 UTSW 7 97579909 unclassified probably benign
R7927:Rsf1 UTSW 7 97579924 unclassified probably benign
R7931:Rsf1 UTSW 7 97579909 unclassified probably benign
R7951:Rsf1 UTSW 7 97579912 unclassified probably benign
R7957:Rsf1 UTSW 7 97579906 unclassified probably benign
R7960:Rsf1 UTSW 7 97579917 unclassified probably benign
R7979:Rsf1 UTSW 7 97685713 missense
R7982:Rsf1 UTSW 7 97579932 unclassified probably benign
R7991:Rsf1 UTSW 7 97661333 missense
R8028:Rsf1 UTSW 7 97579908 unclassified probably benign
R8030:Rsf1 UTSW 7 97579909 unclassified probably benign
R8042:Rsf1 UTSW 7 97579909 unclassified probably benign
R8062:Rsf1 UTSW 7 97677387 missense
R8076:Rsf1 UTSW 7 97579904 unclassified probably benign
R8117:Rsf1 UTSW 7 97639257 splice site probably null
R8132:Rsf1 UTSW 7 97579908 unclassified probably benign
R8153:Rsf1 UTSW 7 97579906 unclassified probably benign
R8155:Rsf1 UTSW 7 97579907 unclassified probably benign
R8166:Rsf1 UTSW 7 97579909 unclassified probably benign
R8197:Rsf1 UTSW 7 97579914 unclassified probably benign
R8235:Rsf1 UTSW 7 97676254 utr 3 prime probably benign
R8245:Rsf1 UTSW 7 97579915 unclassified probably benign
R8282:Rsf1 UTSW 7 97579920 frame shift probably null
R8301:Rsf1 UTSW 7 97661925 missense
R8315:Rsf1 UTSW 7 97579923 unclassified probably benign
R8343:Rsf1 UTSW 7 97579904 unclassified probably benign
R8370:Rsf1 UTSW 7 97579929 unclassified probably benign
R8372:Rsf1 UTSW 7 97662417 missense
R8376:Rsf1 UTSW 7 97579917 unclassified probably benign
R8382:Rsf1 UTSW 7 97579917 unclassified probably benign
R8392:Rsf1 UTSW 7 97579909 unclassified probably benign
R8410:Rsf1 UTSW 7 97579917 unclassified probably benign
R8443:Rsf1 UTSW 7 97616896 missense
R8502:Rsf1 UTSW 7 97579914 unclassified probably benign
R8529:Rsf1 UTSW 7 97670867 utr 3 prime probably benign
R8537:Rsf1 UTSW 7 97579914 unclassified probably benign
R8554:Rsf1 UTSW 7 97579923 unclassified probably benign
R8558:Rsf1 UTSW 7 97579907 unclassified probably benign
R8735:Rsf1 UTSW 7 97579907 unclassified probably benign
R8742:Rsf1 UTSW 7 97579914 unclassified probably benign
R8772:Rsf1 UTSW 7 97579908 unclassified probably benign
R8862:Rsf1 UTSW 7 97579907 unclassified probably benign
R8866:Rsf1 UTSW 7 97579913 unclassified probably benign
R8889:Rsf1 UTSW 7 97579909 unclassified probably benign
R8889:Rsf1 UTSW 7 97678964 missense
R8891:Rsf1 UTSW 7 97579909 unclassified probably benign
R8892:Rsf1 UTSW 7 97678964 missense
R8907:Rsf1 UTSW 7 97579906 unclassified probably benign
R8907:Rsf1 UTSW 7 97579918 unclassified probably benign
R8913:Rsf1 UTSW 7 97579906 unclassified probably benign
R8916:Rsf1 UTSW 7 97579933 unclassified probably benign
R8924:Rsf1 UTSW 7 97579907 unclassified probably benign
R8940:Rsf1 UTSW 7 97579906 unclassified probably benign
R8946:Rsf1 UTSW 7 97579906 unclassified probably benign
R8947:Rsf1 UTSW 7 97681852 unclassified probably benign
R8951:Rsf1 UTSW 7 97579904 unclassified probably benign
R8975:Rsf1 UTSW 7 97579908 unclassified probably benign
R9033:Rsf1 UTSW 7 97579904 unclassified probably benign
R9044:Rsf1 UTSW 7 97579904 unclassified probably benign
R9060:Rsf1 UTSW 7 97579923 unclassified probably benign
R9066:Rsf1 UTSW 7 97579911 unclassified probably benign
R9079:Rsf1 UTSW 7 97579904 unclassified probably benign
R9080:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R9094:Rsf1 UTSW 7 97579909 unclassified probably benign
R9096:Rsf1 UTSW 7 97579907 unclassified probably benign
R9101:Rsf1 UTSW 7 97579907 unclassified probably benign
R9102:Rsf1 UTSW 7 97579931 unclassified probably benign
R9123:Rsf1 UTSW 7 97579909 unclassified probably benign
R9125:Rsf1 UTSW 7 97579908 unclassified probably benign
R9126:Rsf1 UTSW 7 97579908 unclassified probably benign
R9128:Rsf1 UTSW 7 97579909 unclassified probably benign
R9157:Rsf1 UTSW 7 97579906 unclassified probably benign
R9159:Rsf1 UTSW 7 97579908 unclassified probably benign
R9161:Rsf1 UTSW 7 97579906 unclassified probably benign
R9187:Rsf1 UTSW 7 97579933 unclassified probably benign
R9240:Rsf1 UTSW 7 97579912 unclassified probably benign
R9250:Rsf1 UTSW 7 97579914 unclassified probably benign
R9257:Rsf1 UTSW 7 97685711 missense
R9275:Rsf1 UTSW 7 97579923 unclassified probably benign
R9288:Rsf1 UTSW 7 97579912 unclassified probably benign
R9345:Rsf1 UTSW 7 97579932 unclassified probably benign
R9406:Rsf1 UTSW 7 97579911 unclassified probably benign
R9411:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R9414:Rsf1 UTSW 7 97664558 critical splice acceptor site probably null
R9420:Rsf1 UTSW 7 97579927 unclassified probably benign
R9421:Rsf1 UTSW 7 97579934 unclassified probably benign
R9423:Rsf1 UTSW 7 97579909 unclassified probably benign
R9427:Rsf1 UTSW 7 97579909 unclassified probably benign
R9448:Rsf1 UTSW 7 97579909 unclassified probably benign
R9452:Rsf1 UTSW 7 97579926 unclassified probably benign
R9454:Rsf1 UTSW 7 97579923 unclassified probably benign
R9467:Rsf1 UTSW 7 97579913 unclassified probably benign
R9468:Rsf1 UTSW 7 97579920 unclassified probably benign
R9483:Rsf1 UTSW 7 97579930 unclassified probably benign
R9488:Rsf1 UTSW 7 97579922 unclassified probably benign
R9502:Rsf1 UTSW 7 97579909 unclassified probably benign
R9507:Rsf1 UTSW 7 97579934 unclassified probably benign
R9509:Rsf1 UTSW 7 97579920 unclassified probably benign
R9519:Rsf1 UTSW 7 97579909 unclassified probably benign
R9526:Rsf1 UTSW 7 97579932 unclassified probably benign
R9537:Rsf1 UTSW 7 97579914 unclassified probably benign
R9581:Rsf1 UTSW 7 97579918 unclassified probably benign
R9590:Rsf1 UTSW 7 97579911 unclassified probably benign
R9592:Rsf1 UTSW 7 97579911 unclassified probably benign
R9618:Rsf1 UTSW 7 97579909 unclassified probably benign
R9685:Rsf1 UTSW 7 97579932 unclassified probably benign
R9716:Rsf1 UTSW 7 97579932 unclassified probably benign
R9748:Rsf1 UTSW 7 97579906 unclassified probably benign
R9774:Rsf1 UTSW 7 97579931 unclassified probably benign
R9795:Rsf1 UTSW 7 97579904 unclassified probably benign
R9802:Rsf1 UTSW 7 97579906 unclassified probably benign
RF034:Rsf1 UTSW 7 97579908 unclassified probably benign
RF036:Rsf1 UTSW 7 97579908 unclassified probably benign
X0025:Rsf1 UTSW 7 97636444 missense probably damaging 1.00
X0028:Rsf1 UTSW 7 97660824 nonsense probably null
Y4335:Rsf1 UTSW 7 97579904 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGCCTTGAAGTCGTAGAGGG -3'
(R):5'- CAGGGTATCTATGGAGAGCTAAAGC -3'

Sequencing Primer
(F):5'- AGTTCTCGACTGCTCCGG -3'
(R):5'- TTCGGGCCGATCGCTTAC -3'
Posted On 2022-09-12