Incidental Mutation 'R0764:Cdkl2'
ID72544
Institutional Source Beutler Lab
Gene Symbol Cdkl2
Ensembl Gene ENSMUSG00000029403
Gene Namecyclin-dependent kinase-like 2 (CDC2-related kinase)
Synonyms5330436L21Rik, KKIAMRE, Kkm
MMRRC Submission 038944-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0764 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location92006074-92043883 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 92020277 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 353 (V353L)
Ref Sequence ENSEMBL: ENSMUSP00000108768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069937] [ENSMUST00000086978] [ENSMUST00000113140] [ENSMUST00000113143]
Predicted Effect probably benign
Transcript: ENSMUST00000069937
AA Change: V353L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000063617
Gene: ENSMUSG00000029403
AA Change: V353L

DomainStartEndE-ValueType
S_TKc 4 289 2.79e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086978
AA Change: V353L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000084199
Gene: ENSMUSG00000029403
AA Change: V353L

DomainStartEndE-ValueType
S_TKc 4 289 2.79e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113140
AA Change: V353L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108765
Gene: ENSMUSG00000029403
AA Change: V353L

DomainStartEndE-ValueType
S_TKc 4 289 2.79e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113143
AA Change: V353L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108768
Gene: ENSMUSG00000029403
AA Change: V353L

DomainStartEndE-ValueType
S_TKc 4 289 2.79e-95 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136037
Predicted Effect probably benign
Transcript: ENSMUST00000201357
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.1%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of a large family of CDC2-related serine/threonine protein kinases. It accumulates primarily in the cytoplasm, with lower levels in the nucleus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,059,946 Y898N probably damaging Het
Acp4 T C 7: 44,252,314 probably benign Het
Adipor2 T C 6: 119,357,254 I332V probably benign Het
Ago3 T A 4: 126,355,092 K555N possibly damaging Het
Angpt4 A G 2: 151,911,284 probably benign Het
Ano5 G T 7: 51,537,842 probably benign Het
Ap3b1 C T 13: 94,479,879 probably benign Het
BC025446 T A 15: 75,220,723 F97Y probably benign Het
Cbl A T 9: 44,164,152 C399S probably damaging Het
Celsr3 A G 9: 108,827,818 Y500C probably damaging Het
Cep162 A G 9: 87,201,745 S1242P probably damaging Het
Crhr1 C T 11: 104,159,326 R66W probably damaging Het
Ddx49 T C 8: 70,297,257 E170G probably benign Het
Fam193a T C 5: 34,443,341 F305L probably damaging Het
Fam76a C T 4: 132,910,699 G198R probably damaging Het
Gm43302 T A 5: 105,280,489 I130F probably benign Het
Hectd4 T A 5: 121,286,769 I745N possibly damaging Het
Ina T A 19: 47,023,648 *502K probably null Het
Kdm1b A T 13: 47,068,603 D506V possibly damaging Het
Lrrk2 A G 15: 91,775,046 probably null Het
Naip5 A T 13: 100,217,105 D1215E probably benign Het
Neb A G 2: 52,216,867 probably benign Het
Nectin2 T A 7: 19,749,171 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1243 A G 2: 89,527,996 V138A probably benign Het
Olfr170 G T 16: 19,606,432 P79T probably damaging Het
Osbp A G 19: 11,984,156 probably benign Het
Otog A G 7: 46,300,494 D2460G probably benign Het
Pcgf1 T C 6: 83,079,169 C2R probably damaging Het
Per2 C T 1: 91,429,420 V674M probably damaging Het
Pias3 C T 3: 96,701,295 P218S probably damaging Het
Plod3 C T 5: 136,989,583 probably benign Het
Purb C T 11: 6,475,661 V76M probably damaging Het
Ranbp1 C A 16: 18,240,158 E181* probably null Het
Rit2 T C 18: 31,153,701 probably benign Het
Rnf103 C A 6: 71,509,582 T399K probably damaging Het
Slc22a13 T C 9: 119,208,680 probably null Het
Slc35f4 T A 14: 49,306,339 probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tnfrsf17 C T 16: 11,315,199 T47M possibly damaging Het
Tram1 A G 1: 13,579,709 I97T probably damaging Het
Ttc38 T C 15: 85,846,403 probably benign Het
Zfp113 T A 5: 138,145,244 Q248L probably damaging Het
Other mutations in Cdkl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Cdkl2 APN 5 92017377 splice site probably null
IGL02481:Cdkl2 APN 5 92037271 missense probably damaging 1.00
IGL02943:Cdkl2 APN 5 92037244 missense possibly damaging 0.81
IGL03187:Cdkl2 APN 5 92017380 critical splice donor site probably null
IGL03251:Cdkl2 APN 5 92033726 missense probably damaging 1.00
R0422:Cdkl2 UTSW 5 92020312 missense probably benign 0.02
R0616:Cdkl2 UTSW 5 92009004 missense probably benign 0.12
R1023:Cdkl2 UTSW 5 92039286 missense possibly damaging 0.58
R2338:Cdkl2 UTSW 5 92033679 missense possibly damaging 0.92
R2497:Cdkl2 UTSW 5 92008998 missense probably benign 0.44
R3926:Cdkl2 UTSW 5 92033139 missense possibly damaging 0.62
R4444:Cdkl2 UTSW 5 92020309 missense probably benign 0.10
R4445:Cdkl2 UTSW 5 92020309 missense probably benign 0.10
R4446:Cdkl2 UTSW 5 92020309 missense probably benign 0.10
R4647:Cdkl2 UTSW 5 92017213 missense probably damaging 0.99
R4664:Cdkl2 UTSW 5 92037265 missense probably damaging 0.99
R5478:Cdkl2 UTSW 5 92039249 nonsense probably null
R5636:Cdkl2 UTSW 5 92033742 missense probably benign 0.01
R6446:Cdkl2 UTSW 5 92033217 missense probably damaging 1.00
R7051:Cdkl2 UTSW 5 92033225 missense probably damaging 0.99
R7096:Cdkl2 UTSW 5 92033184 nonsense probably null
R7388:Cdkl2 UTSW 5 92019459 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCTGAACGCCAGGAATAGTCCCC -3'
(R):5'- TCCACACTGTCAAGTGAACCAAAGG -3'

Sequencing Primer
(F):5'- TTAATGCCAGGAGCAACTGC -3'
(R):5'- cctgtctgtctgtctgtctg -3'
Posted On2013-09-30