Incidental Mutation 'R9630:Myo15a'
ID 725447
Institutional Source Beutler Lab
Gene Symbol Myo15a
Ensembl Gene ENSMUSG00000042678
Gene Name myosin XVA
Synonyms Myo15
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9630 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 60360165-60419195 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 60407988 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 3159 (C3159S)
Ref Sequence ENSEMBL: ENSMUSP00000071777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071880] [ENSMUST00000081823] [ENSMUST00000094135]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000071880
AA Change: C3159S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000071777
Gene: ENSMUSG00000042678
AA Change: C3159S

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1955 1974 N/A INTRINSIC
low complexity region 1992 2006 N/A INTRINSIC
MyTH4 2049 2195 1.8e-42 SMART
low complexity region 2396 2405 N/A INTRINSIC
low complexity region 2451 2461 N/A INTRINSIC
Blast:MYSc 2665 2848 2e-14 BLAST
SH3 2851 2933 1.55e-4 SMART
low complexity region 2949 2962 N/A INTRINSIC
MyTH4 3031 3185 5.59e-48 SMART
B41 3188 3400 6.94e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081823
AA Change: C1954S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080507
Gene: ENSMUSG00000042678
AA Change: C1954S

DomainStartEndE-ValueType
MYSc 13 697 N/A SMART
IQ 698 720 1.63e-1 SMART
IQ 721 743 1.77e-2 SMART
IQ 744 766 2.97e2 SMART
low complexity region 787 801 N/A INTRINSIC
MyTH4 844 990 1.8e-42 SMART
low complexity region 1191 1200 N/A INTRINSIC
low complexity region 1246 1256 N/A INTRINSIC
Blast:MYSc 1460 1643 7e-15 BLAST
SH3 1646 1728 1.55e-4 SMART
low complexity region 1744 1757 N/A INTRINSIC
MyTH4 1826 1980 5.59e-48 SMART
B41 1983 2195 6.94e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094135
AA Change: C3141S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000091686
Gene: ENSMUSG00000042678
AA Change: C3141S

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1974 1988 N/A INTRINSIC
MyTH4 2031 2177 1.8e-42 SMART
low complexity region 2378 2387 N/A INTRINSIC
low complexity region 2433 2443 N/A INTRINSIC
Blast:MYSc 2647 2830 2e-14 BLAST
SH3 2833 2915 1.55e-4 SMART
low complexity region 2931 2944 N/A INTRINSIC
MyTH4 3013 3167 5.59e-48 SMART
B41 3170 3382 6.94e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an unconventional myosin. This protein differs from other myosins in that it has a long N-terminal extension preceding the conserved motor domain. Studies in mice suggest that this protein is necessary for actin organization in the hair cells of the cochlea. Mutations in this gene have been associated with profound, congenital, neurosensory, nonsyndromal deafness. This gene is located within the Smith-Magenis syndrome region on chromosome 17. Read-through transcripts containing an upstream gene and this gene have been identified, but they are not thought to encode a fusion protein. Several alternatively spliced transcript variants have been described, but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in profound deafness and neurological behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc1l1 A G 6: 48,952,756 (GRCm39) D227G probably damaging Het
Arhgap17 A G 7: 122,907,540 (GRCm39) M274T probably benign Het
Bco2 T C 9: 50,456,757 (GRCm39) T128A possibly damaging Het
Bcr T A 10: 74,966,950 (GRCm39) L519Q probably damaging Het
Cadps2 A T 6: 23,587,571 (GRCm39) S306R probably benign Het
Cage1 T C 13: 38,206,855 (GRCm39) E330G probably damaging Het
Ccdc8 A G 7: 16,728,733 (GRCm39) K74R possibly damaging Het
Cdc42ep2 C A 19: 5,968,363 (GRCm39) G114V Het
Celsr3 T C 9: 108,704,296 (GRCm39) S260P probably benign Het
Clic4 G A 4: 134,944,476 (GRCm39) T233I probably damaging Het
Clip2 C A 5: 134,531,934 (GRCm39) D624Y probably damaging Het
Clock A G 5: 76,393,281 (GRCm39) S221P probably benign Het
Creb3l2 G T 6: 37,356,808 (GRCm39) S86R possibly damaging Het
Cspp1 G A 1: 10,108,292 (GRCm39) probably benign Het
Dusp13b A T 14: 21,784,974 (GRCm39) N128K probably benign Het
Efnb2 T C 8: 8,670,617 (GRCm39) S328G probably damaging Het
Egf A G 3: 129,518,844 (GRCm39) L335P possibly damaging Het
Eml4 T A 17: 83,717,572 (GRCm39) V48D probably damaging Het
Fat2 A C 11: 55,147,605 (GRCm39) V3879G probably benign Het
Fcgbpl1 T C 7: 27,836,624 (GRCm39) L181P probably damaging Het
Flnb T A 14: 7,926,438 (GRCm38) Y1827* probably null Het
Fuca2 A T 10: 13,378,820 (GRCm39) Y71F probably benign Het
Gcn1 C A 5: 115,741,349 (GRCm39) H1463N probably damaging Het
Ifitm10 C T 7: 141,924,909 (GRCm39) A48T probably damaging Het
Iqce T C 5: 140,666,591 (GRCm39) D385G possibly damaging Het
Kdm5b T A 1: 134,512,971 (GRCm39) probably null Het
Kdm7a A T 6: 39,150,239 (GRCm39) S178T probably damaging Het
Mmp12 T A 9: 7,347,516 (GRCm39) M31K probably benign Het
Mon2 C T 10: 122,874,415 (GRCm39) R311H probably damaging Het
Myh15 A G 16: 48,980,341 (GRCm39) T1488A probably benign Het
Nf1 T C 11: 79,302,470 (GRCm39) V346A probably damaging Het
Nfkbib A T 7: 28,461,304 (GRCm39) Y114* probably null Het
Nr2c1 T A 10: 93,998,285 (GRCm39) D76E probably benign Het
Obscn G A 11: 58,943,397 (GRCm39) R4251C probably benign Het
Or1ak2 T C 2: 36,827,653 (GRCm39) I174T probably damaging Het
Or4a74 C A 2: 89,440,349 (GRCm39) M32I probably benign Het
Or5m10b A G 2: 85,699,493 (GRCm39) M186V probably benign Het
Or6c33 T C 10: 129,853,410 (GRCm39) F60S probably damaging Het
Or8h7 A C 2: 86,720,956 (GRCm39) S188A probably damaging Het
Pced1a A T 2: 130,261,109 (GRCm39) I416N probably benign Het
Pdzd2 G T 15: 12,374,443 (GRCm39) D1897E probably benign Het
Pign A T 1: 105,481,591 (GRCm39) F802I probably benign Het
Pik3c2g C A 6: 139,599,237 (GRCm39) Q118K possibly damaging Het
Plcl2 A G 17: 50,947,147 (GRCm39) M1009V probably benign Het
Ppil6 T A 10: 41,370,550 (GRCm39) D59E probably benign Het
Rad23a T C 8: 85,564,919 (GRCm39) D152G probably benign Het
Rif1 A G 2: 51,979,607 (GRCm39) I430V probably damaging Het
Rint1 T C 5: 24,020,810 (GRCm39) V611A possibly damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,229,113 (GRCm39) probably benign Het
Sall4 A G 2: 168,596,408 (GRCm39) S811P probably benign Het
Scaf11 G A 15: 96,316,049 (GRCm39) P1172S probably damaging Het
Sel1l3 T G 5: 53,342,117 (GRCm39) N368H possibly damaging Het
Sele C A 1: 163,879,523 (GRCm39) P352Q probably damaging Het
Serpinf1 T A 11: 75,301,852 (GRCm39) T268S probably benign Het
Sez6 G A 11: 77,865,121 (GRCm39) E623K possibly damaging Het
Sis A T 3: 72,828,722 (GRCm39) N1152K probably benign Het
Slc16a13 T C 11: 70,108,597 (GRCm39) E411G possibly damaging Het
Slc22a23 T C 13: 34,379,390 (GRCm39) N459S possibly damaging Het
Srpk1 C A 17: 28,819,404 (GRCm39) K268N probably benign Het
Ssbp3 A G 4: 106,895,426 (GRCm39) Y258C probably damaging Het
Ssc5d C T 7: 4,939,426 (GRCm39) P621S probably damaging Het
Strada T C 11: 106,077,781 (GRCm39) Q61R unknown Het
Strn3 G A 12: 51,657,013 (GRCm39) T755I probably damaging Het
Taf4b C G 18: 14,930,077 (GRCm39) P150A probably damaging Het
Tmem236 T A 2: 14,223,815 (GRCm39) H201Q probably benign Het
Top3b A G 16: 16,710,354 (GRCm39) E728G probably benign Het
Tshr C T 12: 91,504,409 (GRCm39) P449L probably damaging Het
Ugt2b36 C T 5: 87,239,773 (GRCm39) G204D possibly damaging Het
Vldlr A T 19: 27,207,623 (GRCm39) Q37L probably damaging Het
Zfat A T 15: 67,990,793 (GRCm39) I1031N probably benign Het
Other mutations in Myo15a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00845:Myo15a APN 11 60,368,605 (GRCm39) missense probably damaging 1.00
IGL01011:Myo15a APN 11 60,367,818 (GRCm39) missense probably benign 0.33
IGL01100:Myo15a APN 11 60,401,984 (GRCm39) missense probably damaging 1.00
IGL01357:Myo15a APN 11 60,393,115 (GRCm39) splice site probably benign
IGL01634:Myo15a APN 11 60,386,298 (GRCm39) missense probably damaging 1.00
IGL01763:Myo15a APN 11 60,412,564 (GRCm39) missense probably benign 0.07
IGL01901:Myo15a APN 11 60,418,260 (GRCm39) utr 3 prime probably benign
IGL01931:Myo15a APN 11 60,386,964 (GRCm39) missense probably damaging 1.00
IGL02006:Myo15a APN 11 60,401,954 (GRCm39) missense probably damaging 1.00
IGL02041:Myo15a APN 11 60,397,689 (GRCm39) missense probably damaging 0.99
IGL02094:Myo15a APN 11 60,401,473 (GRCm39) unclassified probably benign
IGL02122:Myo15a APN 11 60,374,292 (GRCm39) missense probably benign 0.23
IGL02153:Myo15a APN 11 60,389,223 (GRCm39) missense probably damaging 1.00
IGL02328:Myo15a APN 11 60,417,433 (GRCm39) missense probably benign 0.13
IGL02330:Myo15a APN 11 60,367,987 (GRCm39) missense possibly damaging 0.94
IGL02431:Myo15a APN 11 60,401,465 (GRCm39) missense possibly damaging 0.73
IGL02639:Myo15a APN 11 60,369,447 (GRCm39) missense probably benign
IGL02659:Myo15a APN 11 60,382,609 (GRCm39) splice site probably benign
IGL02800:Myo15a APN 11 60,393,195 (GRCm39) missense probably damaging 1.00
IGL02812:Myo15a APN 11 60,368,005 (GRCm39) missense probably benign 0.15
IGL02863:Myo15a APN 11 60,368,953 (GRCm39) missense probably damaging 1.00
IGL02873:Myo15a APN 11 60,374,308 (GRCm39) missense probably damaging 1.00
IGL02990:Myo15a APN 11 60,370,266 (GRCm39) missense probably benign 0.02
IGL03011:Myo15a APN 11 60,400,357 (GRCm39) splice site probably benign
IGL03243:Myo15a APN 11 60,387,344 (GRCm39) missense probably damaging 1.00
IGL03297:Myo15a APN 11 60,369,967 (GRCm39) missense probably damaging 1.00
novichok UTSW 11 60,372,566 (GRCm39) critical splice donor site probably null
parker UTSW 11 60,411,740 (GRCm39) critical splice donor site probably null
Typhoon UTSW 11 60,378,251 (GRCm39) critical splice donor site probably null
PIT4131001:Myo15a UTSW 11 60,386,280 (GRCm39) missense probably damaging 1.00
PIT4131001:Myo15a UTSW 11 60,373,953 (GRCm39) missense probably damaging 1.00
R0133:Myo15a UTSW 11 60,368,676 (GRCm39) missense possibly damaging 0.94
R0265:Myo15a UTSW 11 60,405,723 (GRCm39) critical splice acceptor site probably null
R0389:Myo15a UTSW 11 60,369,364 (GRCm39) missense probably benign
R0416:Myo15a UTSW 11 60,402,000 (GRCm39) missense probably damaging 1.00
R0449:Myo15a UTSW 11 60,400,422 (GRCm39) missense possibly damaging 0.92
R0477:Myo15a UTSW 11 60,411,740 (GRCm39) critical splice donor site probably null
R0543:Myo15a UTSW 11 60,369,877 (GRCm39) missense probably benign
R0546:Myo15a UTSW 11 60,397,139 (GRCm39) missense probably damaging 1.00
R0555:Myo15a UTSW 11 60,412,464 (GRCm39) missense probably damaging 1.00
R0639:Myo15a UTSW 11 60,370,162 (GRCm39) missense probably benign 0.12
R0723:Myo15a UTSW 11 60,369,803 (GRCm39) missense possibly damaging 0.94
R0837:Myo15a UTSW 11 60,378,077 (GRCm39) missense probably damaging 0.98
R0865:Myo15a UTSW 11 60,382,514 (GRCm39) missense probably damaging 1.00
R0899:Myo15a UTSW 11 60,368,011 (GRCm39) missense possibly damaging 0.87
R1022:Myo15a UTSW 11 60,370,442 (GRCm39) missense probably benign 0.00
R1024:Myo15a UTSW 11 60,370,442 (GRCm39) missense probably benign 0.00
R1035:Myo15a UTSW 11 60,401,384 (GRCm39) unclassified probably benign
R1109:Myo15a UTSW 11 60,383,892 (GRCm39) missense probably damaging 1.00
R1170:Myo15a UTSW 11 60,370,233 (GRCm39) missense probably benign 0.04
R1241:Myo15a UTSW 11 60,390,256 (GRCm39) missense possibly damaging 0.58
R1392:Myo15a UTSW 11 60,368,800 (GRCm39) missense possibly damaging 0.95
R1392:Myo15a UTSW 11 60,368,800 (GRCm39) missense possibly damaging 0.95
R1434:Myo15a UTSW 11 60,395,157 (GRCm39) missense probably benign 0.00
R1450:Myo15a UTSW 11 60,386,308 (GRCm39) missense probably damaging 1.00
R1456:Myo15a UTSW 11 60,399,028 (GRCm39) missense probably damaging 1.00
R1468:Myo15a UTSW 11 60,396,832 (GRCm39) missense probably damaging 1.00
R1468:Myo15a UTSW 11 60,396,832 (GRCm39) missense probably damaging 1.00
R1548:Myo15a UTSW 11 60,379,064 (GRCm39) missense probably damaging 1.00
R1551:Myo15a UTSW 11 60,383,791 (GRCm39) missense possibly damaging 0.70
R1571:Myo15a UTSW 11 60,409,290 (GRCm39) missense probably damaging 1.00
R1662:Myo15a UTSW 11 60,392,527 (GRCm39) missense probably damaging 1.00
R1777:Myo15a UTSW 11 60,405,762 (GRCm39) missense probably benign
R1778:Myo15a UTSW 11 60,369,238 (GRCm39) missense possibly damaging 0.57
R1847:Myo15a UTSW 11 60,390,321 (GRCm39) nonsense probably null
R1875:Myo15a UTSW 11 60,398,354 (GRCm39) missense probably damaging 0.99
R1944:Myo15a UTSW 11 60,392,909 (GRCm39) missense probably damaging 0.99
R1945:Myo15a UTSW 11 60,392,909 (GRCm39) missense probably damaging 0.99
R2013:Myo15a UTSW 11 60,385,057 (GRCm39) missense probably damaging 1.00
R2107:Myo15a UTSW 11 60,382,636 (GRCm39) missense probably damaging 1.00
R2108:Myo15a UTSW 11 60,382,636 (GRCm39) missense probably damaging 1.00
R2112:Myo15a UTSW 11 60,384,994 (GRCm39) missense probably damaging 0.99
R2147:Myo15a UTSW 11 60,401,055 (GRCm39) missense possibly damaging 0.66
R2196:Myo15a UTSW 11 60,400,847 (GRCm39) nonsense probably null
R2207:Myo15a UTSW 11 60,396,860 (GRCm39) missense probably benign 0.01
R2245:Myo15a UTSW 11 60,399,925 (GRCm39) missense probably damaging 1.00
R2367:Myo15a UTSW 11 60,408,064 (GRCm39) missense probably damaging 0.99
R2374:Myo15a UTSW 11 60,369,669 (GRCm39) missense possibly damaging 0.88
R2438:Myo15a UTSW 11 60,373,878 (GRCm39) missense probably damaging 1.00
R3154:Myo15a UTSW 11 60,370,186 (GRCm39) splice site probably null
R3423:Myo15a UTSW 11 60,401,126 (GRCm39) critical splice donor site probably null
R3551:Myo15a UTSW 11 60,400,489 (GRCm39) missense possibly damaging 0.93
R3552:Myo15a UTSW 11 60,400,489 (GRCm39) missense possibly damaging 0.93
R3612:Myo15a UTSW 11 60,368,505 (GRCm39) missense probably damaging 1.00
R3620:Myo15a UTSW 11 60,369,468 (GRCm39) missense possibly damaging 0.63
R3713:Myo15a UTSW 11 60,370,057 (GRCm39) missense possibly damaging 0.55
R3714:Myo15a UTSW 11 60,370,057 (GRCm39) missense possibly damaging 0.55
R3715:Myo15a UTSW 11 60,370,057 (GRCm39) missense possibly damaging 0.55
R3783:Myo15a UTSW 11 60,368,398 (GRCm39) missense probably damaging 0.97
R3784:Myo15a UTSW 11 60,368,398 (GRCm39) missense probably damaging 0.97
R3785:Myo15a UTSW 11 60,368,398 (GRCm39) missense probably damaging 0.97
R3786:Myo15a UTSW 11 60,368,398 (GRCm39) missense probably damaging 0.97
R3787:Myo15a UTSW 11 60,368,398 (GRCm39) missense probably damaging 0.97
R3894:Myo15a UTSW 11 60,395,145 (GRCm39) missense probably benign 0.00
R3962:Myo15a UTSW 11 60,370,654 (GRCm39) missense probably benign 0.00
R4082:Myo15a UTSW 11 60,378,022 (GRCm39) missense possibly damaging 0.92
R4555:Myo15a UTSW 11 60,387,763 (GRCm39) missense probably damaging 1.00
R4641:Myo15a UTSW 11 60,393,867 (GRCm39) missense probably damaging 1.00
R4665:Myo15a UTSW 11 60,395,705 (GRCm39) critical splice acceptor site probably null
R4713:Myo15a UTSW 11 60,370,756 (GRCm39) missense probably benign 0.21
R4820:Myo15a UTSW 11 60,367,741 (GRCm39) missense probably damaging 0.98
R5013:Myo15a UTSW 11 60,382,493 (GRCm39) missense probably damaging 1.00
R5051:Myo15a UTSW 11 60,378,251 (GRCm39) critical splice donor site probably null
R5187:Myo15a UTSW 11 60,394,440 (GRCm39) missense probably damaging 1.00
R5230:Myo15a UTSW 11 60,393,674 (GRCm39) missense possibly damaging 0.68
R5277:Myo15a UTSW 11 60,367,940 (GRCm39) nonsense probably null
R5345:Myo15a UTSW 11 60,388,364 (GRCm39) missense probably damaging 0.99
R5349:Myo15a UTSW 11 60,384,409 (GRCm39) missense probably damaging 1.00
R5356:Myo15a UTSW 11 60,389,192 (GRCm39) missense probably damaging 1.00
R5445:Myo15a UTSW 11 60,411,603 (GRCm39) nonsense probably null
R5477:Myo15a UTSW 11 60,368,503 (GRCm39) missense probably damaging 1.00
R5629:Myo15a UTSW 11 60,370,578 (GRCm39) missense probably benign
R5728:Myo15a UTSW 11 60,379,722 (GRCm39) missense probably damaging 1.00
R5818:Myo15a UTSW 11 60,388,777 (GRCm39) missense probably benign 0.06
R5952:Myo15a UTSW 11 60,370,246 (GRCm39) missense possibly damaging 0.50
R6338:Myo15a UTSW 11 60,368,959 (GRCm39) missense probably damaging 0.99
R6467:Myo15a UTSW 11 60,417,487 (GRCm39) critical splice donor site probably null
R6488:Myo15a UTSW 11 60,369,313 (GRCm39) missense possibly damaging 0.86
R6521:Myo15a UTSW 11 60,393,195 (GRCm39) missense probably damaging 1.00
R6645:Myo15a UTSW 11 60,368,118 (GRCm39) missense probably benign 0.00
R6702:Myo15a UTSW 11 60,383,818 (GRCm39) missense probably benign 0.16
R6703:Myo15a UTSW 11 60,383,818 (GRCm39) missense probably benign 0.16
R6821:Myo15a UTSW 11 60,415,301 (GRCm39) missense probably damaging 1.00
R6882:Myo15a UTSW 11 60,414,832 (GRCm39) missense probably damaging 1.00
R6908:Myo15a UTSW 11 60,396,832 (GRCm39) missense probably damaging 1.00
R6932:Myo15a UTSW 11 60,390,320 (GRCm39) missense probably damaging 1.00
R6958:Myo15a UTSW 11 60,394,451 (GRCm39) missense probably benign 0.07
R7041:Myo15a UTSW 11 60,396,832 (GRCm39) missense probably damaging 1.00
R7149:Myo15a UTSW 11 60,400,836 (GRCm39) missense possibly damaging 0.56
R7163:Myo15a UTSW 11 60,389,195 (GRCm39) missense
R7229:Myo15a UTSW 11 60,387,321 (GRCm39) missense probably benign 0.08
R7347:Myo15a UTSW 11 60,368,787 (GRCm39) missense probably benign
R7368:Myo15a UTSW 11 60,381,741 (GRCm39) splice site probably null
R7392:Myo15a UTSW 11 60,396,802 (GRCm39) missense
R7414:Myo15a UTSW 11 60,374,309 (GRCm39) missense
R7461:Myo15a UTSW 11 60,395,978 (GRCm39) missense
R7609:Myo15a UTSW 11 60,379,637 (GRCm39) missense
R7613:Myo15a UTSW 11 60,395,978 (GRCm39) missense
R7734:Myo15a UTSW 11 60,401,108 (GRCm39) missense probably benign
R7748:Myo15a UTSW 11 60,395,727 (GRCm39) missense
R7767:Myo15a UTSW 11 60,392,922 (GRCm39) missense
R7769:Myo15a UTSW 11 60,399,975 (GRCm39) missense
R7894:Myo15a UTSW 11 60,381,963 (GRCm39) missense
R7919:Myo15a UTSW 11 60,417,356 (GRCm39) missense probably damaging 1.00
R8100:Myo15a UTSW 11 60,408,016 (GRCm39) missense probably damaging 1.00
R8124:Myo15a UTSW 11 60,398,279 (GRCm39) missense
R8129:Myo15a UTSW 11 60,399,026 (GRCm39) missense
R8428:Myo15a UTSW 11 60,387,241 (GRCm39) missense probably damaging 1.00
R8706:Myo15a UTSW 11 60,370,443 (GRCm39) missense probably benign
R8735:Myo15a UTSW 11 60,401,679 (GRCm39) critical splice acceptor site probably null
R8739:Myo15a UTSW 11 60,368,088 (GRCm39) missense probably benign 0.06
R8790:Myo15a UTSW 11 60,378,047 (GRCm39) missense
R8790:Myo15a UTSW 11 60,367,362 (GRCm39) missense possibly damaging 0.73
R8822:Myo15a UTSW 11 60,367,740 (GRCm39) missense probably damaging 0.99
R8907:Myo15a UTSW 11 60,417,434 (GRCm39) missense
R8931:Myo15a UTSW 11 60,368,020 (GRCm39) missense probably benign
R9061:Myo15a UTSW 11 60,393,692 (GRCm39) missense
R9124:Myo15a UTSW 11 60,369,952 (GRCm39) missense probably benign 0.37
R9297:Myo15a UTSW 11 60,385,899 (GRCm39) missense probably null
R9347:Myo15a UTSW 11 60,374,555 (GRCm39) missense
R9417:Myo15a UTSW 11 60,378,243 (GRCm39) missense
R9456:Myo15a UTSW 11 60,392,668 (GRCm39) missense
R9460:Myo15a UTSW 11 60,372,566 (GRCm39) critical splice donor site probably null
R9615:Myo15a UTSW 11 60,374,320 (GRCm39) missense
R9746:Myo15a UTSW 11 60,378,234 (GRCm39) nonsense probably null
X0021:Myo15a UTSW 11 60,373,185 (GRCm39) nonsense probably null
X0066:Myo15a UTSW 11 60,369,046 (GRCm39) missense probably damaging 1.00
X0067:Myo15a UTSW 11 60,369,444 (GRCm39) missense possibly damaging 0.88
Z1176:Myo15a UTSW 11 60,389,229 (GRCm39) missense
Z1176:Myo15a UTSW 11 60,379,084 (GRCm39) missense
Z1176:Myo15a UTSW 11 60,415,267 (GRCm39) missense probably damaging 1.00
Z1177:Myo15a UTSW 11 60,386,301 (GRCm39) missense
Z1177:Myo15a UTSW 11 60,379,663 (GRCm39) missense
Z1177:Myo15a UTSW 11 60,368,349 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCATGAGGTGTACATTGGC -3'
(R):5'- GTCTGTGCAGGAACCTTCATGTG -3'

Sequencing Primer
(F):5'- GTGTACATTGGCTCCTGCTCAAG -3'
(R):5'- AACCTTCATGTGTGACGATGGAC -3'
Posted On 2022-09-12