Incidental Mutation 'R9630:Slc22a23'
ID 725455
Institutional Source Beutler Lab
Gene Symbol Slc22a23
Ensembl Gene ENSMUSG00000038267
Gene Name solute carrier family 22, member 23
Synonyms 3110004L20Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock # R9630 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 34179158-34345182 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34195407 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 459 (N459S)
Ref Sequence ENSEMBL: ENSMUSP00000042742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040336]
AlphaFold Q3UHH2
Predicted Effect possibly damaging
Transcript: ENSMUST00000040336
AA Change: N459S

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042742
Gene: ENSMUSG00000038267
AA Change: N459S

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
Pfam:Sugar_tr 187 633 5e-26 PFAM
Pfam:MFS_1 224 518 2.6e-13 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000122283
Gene: ENSMUSG00000038267
AA Change: N343S

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
Pfam:Sugar_tr 71 510 1.4e-27 PFAM
Pfam:MFS_1 109 402 1.5e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC22A23 belongs to a large family of transmembrane proteins that function as uniporters, symporters, and antiporters to transport organic ions across cell membranes (Jacobsson et al., 2007 [PubMed 17714910]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,137,199 L181P probably damaging Het
Arhgap17 A G 7: 123,308,317 M274T probably benign Het
Bco2 T C 9: 50,545,457 T128A possibly damaging Het
Bcr T A 10: 75,131,118 L519Q probably damaging Het
Cadps2 A T 6: 23,587,572 S306R probably benign Het
Cage1 T C 13: 38,022,879 E330G probably damaging Het
Ccdc8 A G 7: 16,994,808 K74R possibly damaging Het
Cdc42ep2 C A 19: 5,918,335 G114V Het
Celsr3 T C 9: 108,827,097 S260P probably benign Het
Clic4 G A 4: 135,217,165 T233I probably damaging Het
Clip2 C A 5: 134,503,080 D624Y probably damaging Het
Clock A G 5: 76,245,434 S221P probably benign Het
Creb3l2 G T 6: 37,379,873 S86R possibly damaging Het
Cspp1 G A 1: 10,038,067 probably benign Het
Doxl2 A G 6: 48,975,822 D227G probably damaging Het
Dusp13 A T 14: 21,734,906 N128K probably benign Het
Efnb2 T C 8: 8,620,617 S328G probably damaging Het
Egf A G 3: 129,725,195 L335P possibly damaging Het
Eml4 T A 17: 83,410,143 V48D probably damaging Het
Fat2 A C 11: 55,256,779 V3879G probably benign Het
Flnb T A 14: 7,926,438 Y1827* probably null Het
Fuca2 A T 10: 13,503,076 Y71F probably benign Het
Gcn1l1 C A 5: 115,603,290 H1463N probably damaging Het
Ifitm10 C T 7: 142,371,172 A48T probably damaging Het
Iqce T C 5: 140,680,836 D385G possibly damaging Het
Kdm5b T A 1: 134,585,233 probably null Het
Kdm7a A T 6: 39,173,305 S178T probably damaging Het
Mmp12 T A 9: 7,347,516 M31K probably benign Het
Mon2 C T 10: 123,038,510 R311H probably damaging Het
Myh15 A G 16: 49,159,978 T1488A probably benign Het
Myo15 T A 11: 60,517,162 C3159S probably damaging Het
Nf1 T C 11: 79,411,644 V346A probably damaging Het
Nfkbib A T 7: 28,761,879 Y114* probably null Het
Nr2c1 T A 10: 94,162,423 D76E probably benign Het
Obscn G A 11: 59,052,571 R4251C probably benign Het
Olfr1022 A G 2: 85,869,149 M186V probably benign Het
Olfr1097 A C 2: 86,890,612 S188A probably damaging Het
Olfr1247 C A 2: 89,610,005 M32I probably benign Het
Olfr356 T C 2: 36,937,641 I174T probably damaging Het
Olfr820 T C 10: 130,017,541 F60S probably damaging Het
Pced1a A T 2: 130,419,189 I416N probably benign Het
Pdzd2 G T 15: 12,374,357 D1897E probably benign Het
Pign A T 1: 105,553,866 F802I probably benign Het
Pik3c2g C A 6: 139,622,239 Q118K possibly damaging Het
Plcl2 A G 17: 50,640,119 M1009V probably benign Het
Ppil6 T A 10: 41,494,554 D59E probably benign Het
Rad23a T C 8: 84,838,290 D152G probably benign Het
Rif1 A G 2: 52,089,595 I430V probably damaging Het
Rint1 T C 5: 23,815,812 V611A possibly damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sall4 A G 2: 168,754,488 S811P probably benign Het
Scaf11 G A 15: 96,418,168 P1172S probably damaging Het
Sel1l3 T G 5: 53,184,775 N368H possibly damaging Het
Sele C A 1: 164,051,954 P352Q probably damaging Het
Serpinf1 T A 11: 75,411,026 T268S probably benign Het
Sez6 G A 11: 77,974,295 E623K possibly damaging Het
Sis A T 3: 72,921,389 N1152K probably benign Het
Slc16a13 T C 11: 70,217,771 E411G possibly damaging Het
Srpk1 C A 17: 28,600,430 K268N probably benign Het
Ssbp3 A G 4: 107,038,229 Y258C probably damaging Het
Ssc5d C T 7: 4,936,427 P621S probably damaging Het
Strada T C 11: 106,186,955 Q61R unknown Het
Strn3 G A 12: 51,610,230 T755I probably damaging Het
Taf4b C G 18: 14,797,020 P150A probably damaging Het
Tmem236 T A 2: 14,219,004 H201Q probably benign Het
Top3b A G 16: 16,892,490 E728G probably benign Het
Tshr C T 12: 91,537,635 P449L probably damaging Het
Ugt2b36 C T 5: 87,091,914 G204D possibly damaging Het
Vldlr A T 19: 27,230,223 Q37L probably damaging Het
Zfat A T 15: 68,118,944 I1031N probably benign Het
Other mutations in Slc22a23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Slc22a23 APN 13 34305245 missense probably damaging 1.00
IGL01762:Slc22a23 APN 13 34204001 missense possibly damaging 0.71
IGL02496:Slc22a23 APN 13 34344485 missense possibly damaging 0.93
IGL02516:Slc22a23 APN 13 34203955 missense probably benign 0.02
IGL02831:Slc22a23 APN 13 34299069 missense possibly damaging 0.81
Foreshadowed UTSW 13 34195479 missense probably damaging 0.98
foretold UTSW 13 34305180 missense probably benign 0.08
BB009:Slc22a23 UTSW 13 34182977 missense probably damaging 0.99
BB019:Slc22a23 UTSW 13 34182977 missense probably damaging 0.99
R0234:Slc22a23 UTSW 13 34183261 missense probably damaging 1.00
R0234:Slc22a23 UTSW 13 34183261 missense probably damaging 1.00
R0413:Slc22a23 UTSW 13 34183132 missense probably damaging 1.00
R0557:Slc22a23 UTSW 13 34344383 missense possibly damaging 0.50
R0558:Slc22a23 UTSW 13 34344383 missense possibly damaging 0.50
R0636:Slc22a23 UTSW 13 34299093 missense probably benign 0.01
R0676:Slc22a23 UTSW 13 34195479 missense probably damaging 0.98
R0739:Slc22a23 UTSW 13 34344383 missense possibly damaging 0.50
R0990:Slc22a23 UTSW 13 34195467 missense probably damaging 1.00
R1515:Slc22a23 UTSW 13 34203964 missense probably benign 0.33
R2128:Slc22a23 UTSW 13 34203970 missense possibly damaging 0.76
R2147:Slc22a23 UTSW 13 34183007 missense probably benign 0.00
R3113:Slc22a23 UTSW 13 34183075 missense probably damaging 0.98
R3780:Slc22a23 UTSW 13 34344340 missense probably benign 0.14
R3945:Slc22a23 UTSW 13 34183126 missense probably damaging 0.98
R3946:Slc22a23 UTSW 13 34183126 missense probably damaging 0.98
R4056:Slc22a23 UTSW 13 34299004 nonsense probably null
R4095:Slc22a23 UTSW 13 34305206 missense probably damaging 1.00
R4854:Slc22a23 UTSW 13 34203941 missense probably benign
R5594:Slc22a23 UTSW 13 34305257 missense probably damaging 0.99
R5611:Slc22a23 UTSW 13 34305239 missense probably benign 0.00
R6167:Slc22a23 UTSW 13 34344559 missense probably damaging 0.97
R6927:Slc22a23 UTSW 13 34344379 missense probably benign 0.07
R6933:Slc22a23 UTSW 13 34305180 missense probably benign 0.08
R6960:Slc22a23 UTSW 13 34344157 critical splice donor site probably null
R7291:Slc22a23 UTSW 13 34197839 missense probably damaging 0.99
R7313:Slc22a23 UTSW 13 34183178 missense probably damaging 1.00
R7932:Slc22a23 UTSW 13 34182977 missense probably damaging 0.99
R8058:Slc22a23 UTSW 13 34305184 nonsense probably null
R9385:Slc22a23 UTSW 13 34344578 missense probably benign 0.05
R9560:Slc22a23 UTSW 13 34197868 missense possibly damaging 0.51
X0064:Slc22a23 UTSW 13 34344466 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCAGCCTACTCACAGTTG -3'
(R):5'- AGGTGCTTTGTCCTACACCC -3'

Sequencing Primer
(F):5'- TCACAGTTGAGAAGCCCGAGC -3'
(R):5'- GTGTAGTCACAGCATGCTTTC -3'
Posted On 2022-09-12