Mutagenetix > Incidental Mutation

Incidental Mutation 'R9630:Slc22a23'

725455

Institutional Source

Beutler Lab

Gene Symbol

Slc22a23

Ensembl Gene

ENSMUSG00000038267

Gene Name

solute carrier family 22, member 23

Synonyms

3110004L20Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.204) question?

Stock #

R9630 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

34179158-34345182 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34195407 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 459 (N459S)

Ref Sequence

ENSEMBL: ENSMUSP00000042742 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040336]

AlphaFold

Q3UHH2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040336
AA Change: N459S

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000042742
Gene: ENSMUSG00000038267
AA Change: N459S

Domain	Start	End	E-Value	Type
low complexity region	5	16	N/A	INTRINSIC
low complexity region	153	164	N/A	INTRINSIC
Pfam:Sugar_tr	187	633	5e-26	PFAM
Pfam:MFS_1	224	518	2.6e-13	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000122283
Gene: ENSMUSG00000038267
AA Change: N343S

Domain	Start	End	E-Value	Type
low complexity region	38	49	N/A	INTRINSIC
Pfam:Sugar_tr	71	510	1.4e-27	PFAM
Pfam:MFS_1	109	402	1.5e-12	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC22A23 belongs to a large family of transmembrane proteins that function as uniporters, symporters, and antiporters to transport organic ions across cell membranes (Jacobsson et al., 2007 [PubMed 17714910]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	T	C	7: 28,137,199	L181P	probably damaging	Het
Arhgap17	A	G	7: 123,308,317	M274T	probably benign	Het
Bco2	T	C	9: 50,545,457	T128A	possibly damaging	Het
Bcr	T	A	10: 75,131,118	L519Q	probably damaging	Het
Cadps2	A	T	6: 23,587,572	S306R	probably benign	Het
Cage1	T	C	13: 38,022,879	E330G	probably damaging	Het
Ccdc8	A	G	7: 16,994,808	K74R	possibly damaging	Het
Cdc42ep2	C	A	19: 5,918,335	G114V		Het
Celsr3	T	C	9: 108,827,097	S260P	probably benign	Het
Clic4	G	A	4: 135,217,165	T233I	probably damaging	Het
Clip2	C	A	5: 134,503,080	D624Y	probably damaging	Het
Clock	A	G	5: 76,245,434	S221P	probably benign	Het
Creb3l2	G	T	6: 37,379,873	S86R	possibly damaging	Het
Cspp1	G	A	1: 10,038,067		probably benign	Het
Doxl2	A	G	6: 48,975,822	D227G	probably damaging	Het
Dusp13	A	T	14: 21,734,906	N128K	probably benign	Het
Efnb2	T	C	8: 8,620,617	S328G	probably damaging	Het
Egf	A	G	3: 129,725,195	L335P	possibly damaging	Het
Eml4	T	A	17: 83,410,143	V48D	probably damaging	Het
Fat2	A	C	11: 55,256,779	V3879G	probably benign	Het
Flnb	T	A	14: 7,926,438	Y1827*	probably null	Het
Fuca2	A	T	10: 13,503,076	Y71F	probably benign	Het
Gcn1l1	C	A	5: 115,603,290	H1463N	probably damaging	Het
Ifitm10	C	T	7: 142,371,172	A48T	probably damaging	Het
Iqce	T	C	5: 140,680,836	D385G	possibly damaging	Het
Kdm5b	T	A	1: 134,585,233		probably null	Het
Kdm7a	A	T	6: 39,173,305	S178T	probably damaging	Het
Mmp12	T	A	9: 7,347,516	M31K	probably benign	Het
Mon2	C	T	10: 123,038,510	R311H	probably damaging	Het
Myh15	A	G	16: 49,159,978	T1488A	probably benign	Het
Myo15	T	A	11: 60,517,162	C3159S	probably damaging	Het
Nf1	T	C	11: 79,411,644	V346A	probably damaging	Het
Nfkbib	A	T	7: 28,761,879	Y114*	probably null	Het
Nr2c1	T	A	10: 94,162,423	D76E	probably benign	Het
Obscn	G	A	11: 59,052,571	R4251C	probably benign	Het
Olfr1022	A	G	2: 85,869,149	M186V	probably benign	Het
Olfr1097	A	C	2: 86,890,612	S188A	probably damaging	Het
Olfr1247	C	A	2: 89,610,005	M32I	probably benign	Het
Olfr356	T	C	2: 36,937,641	I174T	probably damaging	Het
Olfr820	T	C	10: 130,017,541	F60S	probably damaging	Het
Pced1a	A	T	2: 130,419,189	I416N	probably benign	Het
Pdzd2	G	T	15: 12,374,357	D1897E	probably benign	Het
Pign	A	T	1: 105,553,866	F802I	probably benign	Het
Pik3c2g	C	A	6: 139,622,239	Q118K	possibly damaging	Het
Plcl2	A	G	17: 50,640,119	M1009V	probably benign	Het
Ppil6	T	A	10: 41,494,554	D59E	probably benign	Het
Rad23a	T	C	8: 84,838,290	D152G	probably benign	Het
Rif1	A	G	2: 52,089,595	I430V	probably damaging	Het
Rint1	T	C	5: 23,815,812	V611A	possibly damaging	Het
Rsf1	GGCG	GGCGACGGCCGCG	7: 97,579,906		probably benign	Het
Sall4	A	G	2: 168,754,488	S811P	probably benign	Het
Scaf11	G	A	15: 96,418,168	P1172S	probably damaging	Het
Sel1l3	T	G	5: 53,184,775	N368H	possibly damaging	Het
Sele	C	A	1: 164,051,954	P352Q	probably damaging	Het
Serpinf1	T	A	11: 75,411,026	T268S	probably benign	Het
Sez6	G	A	11: 77,974,295	E623K	possibly damaging	Het
Sis	A	T	3: 72,921,389	N1152K	probably benign	Het
Slc16a13	T	C	11: 70,217,771	E411G	possibly damaging	Het
Srpk1	C	A	17: 28,600,430	K268N	probably benign	Het
Ssbp3	A	G	4: 107,038,229	Y258C	probably damaging	Het
Ssc5d	C	T	7: 4,936,427	P621S	probably damaging	Het
Strada	T	C	11: 106,186,955	Q61R	unknown	Het
Strn3	G	A	12: 51,610,230	T755I	probably damaging	Het
Taf4b	C	G	18: 14,797,020	P150A	probably damaging	Het
Tmem236	T	A	2: 14,219,004	H201Q	probably benign	Het
Top3b	A	G	16: 16,892,490	E728G	probably benign	Het
Tshr	C	T	12: 91,537,635	P449L	probably damaging	Het
Ugt2b36	C	T	5: 87,091,914	G204D	possibly damaging	Het
Vldlr	A	T	19: 27,230,223	Q37L	probably damaging	Het
Zfat	A	T	15: 68,118,944	I1031N	probably benign	Het

Other mutations in Slc22a23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00327:Slc22a23	APN	13	34305245	missense	probably damaging	1.00
IGL01762:Slc22a23	APN	13	34204001	missense	possibly damaging	0.71
IGL02496:Slc22a23	APN	13	34344485	missense	possibly damaging	0.93
IGL02516:Slc22a23	APN	13	34203955	missense	probably benign	0.02
IGL02831:Slc22a23	APN	13	34299069	missense	possibly damaging	0.81
Foreshadowed	UTSW	13	34195479	missense	probably damaging	0.98
foretold	UTSW	13	34305180	missense	probably benign	0.08
BB009:Slc22a23	UTSW	13	34182977	missense	probably damaging	0.99
BB019:Slc22a23	UTSW	13	34182977	missense	probably damaging	0.99
R0234:Slc22a23	UTSW	13	34183261	missense	probably damaging	1.00
R0234:Slc22a23	UTSW	13	34183261	missense	probably damaging	1.00
R0413:Slc22a23	UTSW	13	34183132	missense	probably damaging	1.00
R0557:Slc22a23	UTSW	13	34344383	missense	possibly damaging	0.50
R0558:Slc22a23	UTSW	13	34344383	missense	possibly damaging	0.50
R0636:Slc22a23	UTSW	13	34299093	missense	probably benign	0.01
R0676:Slc22a23	UTSW	13	34195479	missense	probably damaging	0.98
R0739:Slc22a23	UTSW	13	34344383	missense	possibly damaging	0.50
R0990:Slc22a23	UTSW	13	34195467	missense	probably damaging	1.00
R1515:Slc22a23	UTSW	13	34203964	missense	probably benign	0.33
R2128:Slc22a23	UTSW	13	34203970	missense	possibly damaging	0.76
R2147:Slc22a23	UTSW	13	34183007	missense	probably benign	0.00
R3113:Slc22a23	UTSW	13	34183075	missense	probably damaging	0.98
R3780:Slc22a23	UTSW	13	34344340	missense	probably benign	0.14
R3945:Slc22a23	UTSW	13	34183126	missense	probably damaging	0.98
R3946:Slc22a23	UTSW	13	34183126	missense	probably damaging	0.98
R4056:Slc22a23	UTSW	13	34299004	nonsense	probably null
R4095:Slc22a23	UTSW	13	34305206	missense	probably damaging	1.00
R4854:Slc22a23	UTSW	13	34203941	missense	probably benign
R5594:Slc22a23	UTSW	13	34305257	missense	probably damaging	0.99
R5611:Slc22a23	UTSW	13	34305239	missense	probably benign	0.00
R6167:Slc22a23	UTSW	13	34344559	missense	probably damaging	0.97
R6927:Slc22a23	UTSW	13	34344379	missense	probably benign	0.07
R6933:Slc22a23	UTSW	13	34305180	missense	probably benign	0.08
R6960:Slc22a23	UTSW	13	34344157	critical splice donor site	probably null
R7291:Slc22a23	UTSW	13	34197839	missense	probably damaging	0.99
R7313:Slc22a23	UTSW	13	34183178	missense	probably damaging	1.00
R7932:Slc22a23	UTSW	13	34182977	missense	probably damaging	0.99
R8058:Slc22a23	UTSW	13	34305184	nonsense	probably null
R9385:Slc22a23	UTSW	13	34344578	missense	probably benign	0.05
R9560:Slc22a23	UTSW	13	34197868	missense	possibly damaging	0.51
X0064:Slc22a23	UTSW	13	34344466	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCCAGCCTACTCACAGTTG -3'
(R):5'- AGGTGCTTTGTCCTACACCC -3'

Sequencing Primer
(F):5'- TCACAGTTGAGAAGCCCGAGC -3'
(R):5'- GTGTAGTCACAGCATGCTTTC -3'

Posted On

2022-09-12