Incidental Mutation 'R9630:Myh15'
ID 725463
Institutional Source Beutler Lab
Gene Symbol Myh15
Ensembl Gene ENSMUSG00000092009
Gene Name myosin, heavy chain 15
Synonyms EG667772
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock # R9630 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 49057486-49199104 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 49159978 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1488 (T1488A)
Ref Sequence ENSEMBL: ENSMUSP00000127539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168680]
AlphaFold E9Q264
Predicted Effect probably benign
Transcript: ENSMUST00000168680
AA Change: T1488A

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000127539
Gene: ENSMUSG00000092009
AA Change: T1488A

DomainStartEndE-ValueType
Pfam:Myosin_N 30 70 5.2e-12 PFAM
MYSc 76 770 N/A SMART
Pfam:Myosin_tail_1 836 1915 9.5e-118 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,137,199 L181P probably damaging Het
Arhgap17 A G 7: 123,308,317 M274T probably benign Het
Bco2 T C 9: 50,545,457 T128A possibly damaging Het
Bcr T A 10: 75,131,118 L519Q probably damaging Het
Cadps2 A T 6: 23,587,572 S306R probably benign Het
Cage1 T C 13: 38,022,879 E330G probably damaging Het
Ccdc8 A G 7: 16,994,808 K74R possibly damaging Het
Cdc42ep2 C A 19: 5,918,335 G114V Het
Celsr3 T C 9: 108,827,097 S260P probably benign Het
Clic4 G A 4: 135,217,165 T233I probably damaging Het
Clip2 C A 5: 134,503,080 D624Y probably damaging Het
Clock A G 5: 76,245,434 S221P probably benign Het
Creb3l2 G T 6: 37,379,873 S86R possibly damaging Het
Cspp1 G A 1: 10,038,067 probably benign Het
Doxl2 A G 6: 48,975,822 D227G probably damaging Het
Dusp13 A T 14: 21,734,906 N128K probably benign Het
Efnb2 T C 8: 8,620,617 S328G probably damaging Het
Egf A G 3: 129,725,195 L335P possibly damaging Het
Eml4 T A 17: 83,410,143 V48D probably damaging Het
Fat2 A C 11: 55,256,779 V3879G probably benign Het
Flnb T A 14: 7,926,438 Y1827* probably null Het
Fuca2 A T 10: 13,503,076 Y71F probably benign Het
Gcn1l1 C A 5: 115,603,290 H1463N probably damaging Het
Ifitm10 C T 7: 142,371,172 A48T probably damaging Het
Iqce T C 5: 140,680,836 D385G possibly damaging Het
Kdm5b T A 1: 134,585,233 probably null Het
Kdm7a A T 6: 39,173,305 S178T probably damaging Het
Mmp12 T A 9: 7,347,516 M31K probably benign Het
Mon2 C T 10: 123,038,510 R311H probably damaging Het
Myo15 T A 11: 60,517,162 C3159S probably damaging Het
Nf1 T C 11: 79,411,644 V346A probably damaging Het
Nfkbib A T 7: 28,761,879 Y114* probably null Het
Nr2c1 T A 10: 94,162,423 D76E probably benign Het
Obscn G A 11: 59,052,571 R4251C probably benign Het
Olfr1022 A G 2: 85,869,149 M186V probably benign Het
Olfr1097 A C 2: 86,890,612 S188A probably damaging Het
Olfr1247 C A 2: 89,610,005 M32I probably benign Het
Olfr356 T C 2: 36,937,641 I174T probably damaging Het
Olfr820 T C 10: 130,017,541 F60S probably damaging Het
Pced1a A T 2: 130,419,189 I416N probably benign Het
Pdzd2 G T 15: 12,374,357 D1897E probably benign Het
Pign A T 1: 105,553,866 F802I probably benign Het
Pik3c2g C A 6: 139,622,239 Q118K possibly damaging Het
Plcl2 A G 17: 50,640,119 M1009V probably benign Het
Ppil6 T A 10: 41,494,554 D59E probably benign Het
Rad23a T C 8: 84,838,290 D152G probably benign Het
Rif1 A G 2: 52,089,595 I430V probably damaging Het
Rint1 T C 5: 23,815,812 V611A possibly damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sall4 A G 2: 168,754,488 S811P probably benign Het
Scaf11 G A 15: 96,418,168 P1172S probably damaging Het
Sel1l3 T G 5: 53,184,775 N368H possibly damaging Het
Sele C A 1: 164,051,954 P352Q probably damaging Het
Serpinf1 T A 11: 75,411,026 T268S probably benign Het
Sez6 G A 11: 77,974,295 E623K possibly damaging Het
Sis A T 3: 72,921,389 N1152K probably benign Het
Slc16a13 T C 11: 70,217,771 E411G possibly damaging Het
Slc22a23 T C 13: 34,195,407 N459S possibly damaging Het
Srpk1 C A 17: 28,600,430 K268N probably benign Het
Ssbp3 A G 4: 107,038,229 Y258C probably damaging Het
Ssc5d C T 7: 4,936,427 P621S probably damaging Het
Strada T C 11: 106,186,955 Q61R unknown Het
Strn3 G A 12: 51,610,230 T755I probably damaging Het
Taf4b C G 18: 14,797,020 P150A probably damaging Het
Tmem236 T A 2: 14,219,004 H201Q probably benign Het
Top3b A G 16: 16,892,490 E728G probably benign Het
Tshr C T 12: 91,537,635 P449L probably damaging Het
Ugt2b36 C T 5: 87,091,914 G204D possibly damaging Het
Vldlr A T 19: 27,230,223 Q37L probably damaging Het
Zfat A T 15: 68,118,944 I1031N probably benign Het
Other mutations in Myh15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Myh15 APN 16 49165813 missense probably damaging 0.98
IGL01095:Myh15 APN 16 49132015 missense probably damaging 1.00
IGL01343:Myh15 APN 16 49155677 missense probably benign 0.09
IGL01474:Myh15 APN 16 49132098 missense probably damaging 1.00
IGL01572:Myh15 APN 16 49100222 missense possibly damaging 0.55
IGL01595:Myh15 APN 16 49172949 missense probably damaging 1.00
IGL01632:Myh15 APN 16 49061511 missense probably benign 0.00
IGL01638:Myh15 APN 16 49069480 missense probably damaging 1.00
IGL01667:Myh15 APN 16 49195579 missense probably benign 0.20
IGL01715:Myh15 APN 16 49057484 unclassified probably benign
IGL01833:Myh15 APN 16 49114058 missense probably damaging 1.00
IGL02004:Myh15 APN 16 49110529 splice site probably benign
IGL02033:Myh15 APN 16 49145344 missense probably benign 0.05
IGL02148:Myh15 APN 16 49116315 missense probably damaging 1.00
IGL02225:Myh15 APN 16 49091163 missense probably benign 0.14
IGL02249:Myh15 APN 16 49110484 missense probably damaging 0.99
IGL02505:Myh15 APN 16 49117263 missense possibly damaging 0.90
IGL02622:Myh15 APN 16 49176954 missense probably benign 0.02
IGL02814:Myh15 APN 16 49145438 splice site probably benign
IGL02869:Myh15 APN 16 49145404 missense probably benign
IGL02879:Myh15 APN 16 49173059 missense possibly damaging 0.68
IGL02881:Myh15 APN 16 49117265 missense possibly damaging 0.51
IGL03077:Myh15 APN 16 49096538 missense probably benign 0.10
IGL03354:Myh15 APN 16 49172010 missense probably benign 0.01
IGL03411:Myh15 APN 16 49159967 missense possibly damaging 0.58
ANU74:Myh15 UTSW 16 49172932 missense possibly damaging 0.58
P0027:Myh15 UTSW 16 49081208 missense possibly damaging 0.77
PIT1430001:Myh15 UTSW 16 49196891 critical splice donor site probably null
R0017:Myh15 UTSW 16 49163060 missense probably damaging 0.97
R0038:Myh15 UTSW 16 49071141 splice site probably benign
R0149:Myh15 UTSW 16 49114005 missense probably benign 0.01
R0361:Myh15 UTSW 16 49114005 missense probably benign 0.01
R0373:Myh15 UTSW 16 49182959 missense possibly damaging 0.86
R0433:Myh15 UTSW 16 49145236 missense probably damaging 1.00
R0525:Myh15 UTSW 16 49132051 missense probably benign 0.03
R0586:Myh15 UTSW 16 49171887 splice site probably benign
R0601:Myh15 UTSW 16 49061581 missense probably damaging 1.00
R0717:Myh15 UTSW 16 49142993 missense probably benign 0.03
R0963:Myh15 UTSW 16 49132149 missense probably damaging 0.97
R1075:Myh15 UTSW 16 49120054 missense possibly damaging 0.63
R1143:Myh15 UTSW 16 49065086 missense probably benign 0.02
R1200:Myh15 UTSW 16 49096519 missense probably damaging 1.00
R1644:Myh15 UTSW 16 49132203 missense probably benign 0.12
R1646:Myh15 UTSW 16 49195568 missense probably damaging 1.00
R1720:Myh15 UTSW 16 49092782 missense probably damaging 1.00
R1768:Myh15 UTSW 16 49163135 missense probably benign 0.27
R1881:Myh15 UTSW 16 49071083 missense probably damaging 0.98
R2048:Myh15 UTSW 16 49155565 missense probably damaging 0.99
R2064:Myh15 UTSW 16 49155621 missense possibly damaging 0.50
R2184:Myh15 UTSW 16 49137511 missense probably damaging 0.99
R2212:Myh15 UTSW 16 49138732 missense probably benign 0.02
R2216:Myh15 UTSW 16 49165838 nonsense probably null
R2321:Myh15 UTSW 16 49113073 missense possibly damaging 0.93
R2327:Myh15 UTSW 16 49142950 missense probably benign 0.01
R2395:Myh15 UTSW 16 49069514 missense probably benign 0.04
R2399:Myh15 UTSW 16 49137589 missense probably damaging 0.97
R3413:Myh15 UTSW 16 49138732 missense probably benign 0.02
R4234:Myh15 UTSW 16 49163042 missense probably benign 0.04
R4382:Myh15 UTSW 16 49142943 missense probably benign 0.03
R4421:Myh15 UTSW 16 49109344 missense probably damaging 0.99
R4580:Myh15 UTSW 16 49065025 missense possibly damaging 0.93
R4657:Myh15 UTSW 16 49172058 nonsense probably null
R4780:Myh15 UTSW 16 49120057 missense probably benign 0.13
R5004:Myh15 UTSW 16 49132048 missense probably damaging 0.99
R5175:Myh15 UTSW 16 49069426 missense possibly damaging 0.85
R5189:Myh15 UTSW 16 49101507 missense probably benign 0.20
R5311:Myh15 UTSW 16 49165841 missense possibly damaging 0.94
R5318:Myh15 UTSW 16 49110471 missense probably damaging 0.99
R5404:Myh15 UTSW 16 49159978 missense probably benign 0.15
R5415:Myh15 UTSW 16 49117295 missense probably null 1.00
R5558:Myh15 UTSW 16 49069537 missense probably benign 0.32
R5977:Myh15 UTSW 16 49153503 missense probably damaging 1.00
R6004:Myh15 UTSW 16 49159699 missense probably benign 0.00
R6275:Myh15 UTSW 16 49145247 missense probably benign 0.00
R6381:Myh15 UTSW 16 49101481 missense probably damaging 1.00
R6448:Myh15 UTSW 16 49171932 missense probably damaging 0.99
R6516:Myh15 UTSW 16 49137633 missense probably benign 0.19
R6752:Myh15 UTSW 16 49182927 missense probably damaging 1.00
R6847:Myh15 UTSW 16 49145088 missense possibly damaging 0.70
R6868:Myh15 UTSW 16 49069403 missense probably damaging 1.00
R6889:Myh15 UTSW 16 49153111 missense possibly damaging 0.75
R6896:Myh15 UTSW 16 49113071 missense probably benign 0.44
R6955:Myh15 UTSW 16 49081235 critical splice donor site probably null
R6984:Myh15 UTSW 16 49110412 missense probably damaging 1.00
R7046:Myh15 UTSW 16 49109299 nonsense probably null
R7095:Myh15 UTSW 16 49171909 missense possibly damaging 0.90
R7098:Myh15 UTSW 16 49177057 missense possibly damaging 0.53
R7134:Myh15 UTSW 16 49081342 missense possibly damaging 0.86
R7159:Myh15 UTSW 16 49061574 missense probably damaging 0.97
R7244:Myh15 UTSW 16 49196786 missense probably damaging 1.00
R7278:Myh15 UTSW 16 49091105 missense probably damaging 0.98
R7309:Myh15 UTSW 16 49096465 missense probably benign 0.34
R7327:Myh15 UTSW 16 49173006 missense possibly damaging 0.88
R7418:Myh15 UTSW 16 49155537 missense possibly damaging 0.69
R7937:Myh15 UTSW 16 49155646 missense probably benign 0.00
R8053:Myh15 UTSW 16 49142939 missense possibly damaging 0.89
R8313:Myh15 UTSW 16 49120018 missense probably damaging 0.99
R8315:Myh15 UTSW 16 49120018 missense probably damaging 0.99
R8316:Myh15 UTSW 16 49120018 missense probably damaging 0.99
R8317:Myh15 UTSW 16 49120018 missense probably damaging 0.99
R8342:Myh15 UTSW 16 49092757 missense probably benign
R8379:Myh15 UTSW 16 49081188 missense probably benign
R8445:Myh15 UTSW 16 49120018 missense probably damaging 0.99
R8707:Myh15 UTSW 16 49153087 missense probably damaging 1.00
R8729:Myh15 UTSW 16 49061488 missense probably damaging 0.97
R8773:Myh15 UTSW 16 49195537 missense possibly damaging 0.89
R8869:Myh15 UTSW 16 49177003 missense probably benign
R8890:Myh15 UTSW 16 49138767 missense probably damaging 1.00
R9026:Myh15 UTSW 16 49187070 missense probably damaging 1.00
R9063:Myh15 UTSW 16 49092755 missense probably benign 0.00
R9290:Myh15 UTSW 16 49177012 missense probably damaging 1.00
R9710:Myh15 UTSW 16 49138681 missense probably damaging 1.00
X0012:Myh15 UTSW 16 49142978 missense probably damaging 1.00
X0020:Myh15 UTSW 16 49165874 missense probably damaging 1.00
Z1176:Myh15 UTSW 16 49096531 missense probably damaging 0.98
Z1177:Myh15 UTSW 16 49081228 missense probably benign 0.02
Z1177:Myh15 UTSW 16 49155618 missense probably damaging 0.97
Z1177:Myh15 UTSW 16 49159826 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ATGCCAAGAATGCCTCCCTG -3'
(R):5'- GGTGTGGCCCTAATATTACCTTTAG -3'

Sequencing Primer
(F):5'- CCTTTCTGACCTGGGGAAG -3'
(R):5'- AGACAGCTTTGCCCTGAA -3'
Posted On 2022-09-12