Incidental Mutation 'R0764:Plod3'
ID72547
Institutional Source Beutler Lab
Gene Symbol Plod3
Ensembl Gene ENSMUSG00000004846
Gene Nameprocollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
Synonymslysyl hydroxylase 3, LH3
MMRRC Submission 038944-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0764 (G1)
Quality Score193
Status Validated
Chromosome5
Chromosomal Location136987019-136996648 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 136989583 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004968] [ENSMUST00000034953] [ENSMUST00000085941] [ENSMUST00000111090] [ENSMUST00000111091] [ENSMUST00000137272] [ENSMUST00000156963]
Predicted Effect probably benign
Transcript: ENSMUST00000004968
SMART Domains Protein: ENSMUSP00000004968
Gene: ENSMUSG00000004846

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 312 324 N/A INTRINSIC
Blast:P4Hc 456 502 2e-8 BLAST
P4Hc 567 740 1.43e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000034953
SMART Domains Protein: ENSMUSP00000034953
Gene: ENSMUSG00000059518

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:zf-HIT 112 141 6.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085941
SMART Domains Protein: ENSMUSP00000083103
Gene: ENSMUSG00000059518

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
low complexity region 59 74 N/A INTRINSIC
Pfam:zf-HIT 113 142 3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102285
Predicted Effect probably benign
Transcript: ENSMUST00000111090
SMART Domains Protein: ENSMUSP00000106719
Gene: ENSMUSG00000059518

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:zf-HIT 112 141 2.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111091
SMART Domains Protein: ENSMUSP00000106720
Gene: ENSMUSG00000059518

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
low complexity region 63 78 N/A INTRINSIC
Pfam:zf-HIT 117 146 2.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127100
SMART Domains Protein: ENSMUSP00000123550
Gene: ENSMUSG00000004846

DomainStartEndE-ValueType
Blast:P4Hc 2 35 2e-11 BLAST
P4Hc 38 200 3.04e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129896
Predicted Effect probably benign
Transcript: ENSMUST00000137272
SMART Domains Protein: ENSMUSP00000120331
Gene: ENSMUSG00000059518

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151642
Predicted Effect probably benign
Transcript: ENSMUST00000156963
SMART Domains Protein: ENSMUSP00000115929
Gene: ENSMUSG00000059518

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:zf-HIT 112 141 6.7e-13 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.1%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound homodimeric enzyme that is localized to the cisternae of the rough endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VIB have deficiencies in lysyl hydroxylase activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality, reduced embryonic growth, fragility, and fragmented basement membranes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,059,946 Y898N probably damaging Het
Acp4 T C 7: 44,252,314 probably benign Het
Adipor2 T C 6: 119,357,254 I332V probably benign Het
Ago3 T A 4: 126,355,092 K555N possibly damaging Het
Angpt4 A G 2: 151,911,284 probably benign Het
Ano5 G T 7: 51,537,842 probably benign Het
Ap3b1 C T 13: 94,479,879 probably benign Het
BC025446 T A 15: 75,220,723 F97Y probably benign Het
Cbl A T 9: 44,164,152 C399S probably damaging Het
Cdkl2 C A 5: 92,020,277 V353L probably benign Het
Celsr3 A G 9: 108,827,818 Y500C probably damaging Het
Cep162 A G 9: 87,201,745 S1242P probably damaging Het
Crhr1 C T 11: 104,159,326 R66W probably damaging Het
Ddx49 T C 8: 70,297,257 E170G probably benign Het
Fam193a T C 5: 34,443,341 F305L probably damaging Het
Fam76a C T 4: 132,910,699 G198R probably damaging Het
Gm43302 T A 5: 105,280,489 I130F probably benign Het
Hectd4 T A 5: 121,286,769 I745N possibly damaging Het
Ina T A 19: 47,023,648 *502K probably null Het
Kdm1b A T 13: 47,068,603 D506V possibly damaging Het
Lrrk2 A G 15: 91,775,046 probably null Het
Naip5 A T 13: 100,217,105 D1215E probably benign Het
Neb A G 2: 52,216,867 probably benign Het
Nectin2 T A 7: 19,749,171 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1243 A G 2: 89,527,996 V138A probably benign Het
Olfr170 G T 16: 19,606,432 P79T probably damaging Het
Osbp A G 19: 11,984,156 probably benign Het
Otog A G 7: 46,300,494 D2460G probably benign Het
Pcgf1 T C 6: 83,079,169 C2R probably damaging Het
Per2 C T 1: 91,429,420 V674M probably damaging Het
Pias3 C T 3: 96,701,295 P218S probably damaging Het
Purb C T 11: 6,475,661 V76M probably damaging Het
Ranbp1 C A 16: 18,240,158 E181* probably null Het
Rit2 T C 18: 31,153,701 probably benign Het
Rnf103 C A 6: 71,509,582 T399K probably damaging Het
Slc22a13 T C 9: 119,208,680 probably null Het
Slc35f4 T A 14: 49,306,339 probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tnfrsf17 C T 16: 11,315,199 T47M possibly damaging Het
Tram1 A G 1: 13,579,709 I97T probably damaging Het
Ttc38 T C 15: 85,846,403 probably benign Het
Zfp113 T A 5: 138,145,244 Q248L probably damaging Het
Other mutations in Plod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Plod3 APN 5 136996176 missense possibly damaging 0.78
IGL01090:Plod3 APN 5 136990236 missense probably benign 0.37
IGL01443:Plod3 APN 5 136990221 missense probably benign 0.17
IGL01583:Plod3 APN 5 136996148 missense probably benign 0.02
R0544:Plod3 UTSW 5 136991611 missense probably benign 0.09
R0747:Plod3 UTSW 5 136988195 missense probably benign 0.34
R1520:Plod3 UTSW 5 136991311 missense probably damaging 0.99
R1631:Plod3 UTSW 5 136988993 missense probably damaging 1.00
R1751:Plod3 UTSW 5 136990176 missense possibly damaging 0.89
R1767:Plod3 UTSW 5 136990176 missense possibly damaging 0.89
R1984:Plod3 UTSW 5 136990853 splice site probably null
R1985:Plod3 UTSW 5 136990853 splice site probably null
R2137:Plod3 UTSW 5 136988717 missense probably damaging 1.00
R2148:Plod3 UTSW 5 136987773 nonsense probably null
R2179:Plod3 UTSW 5 136991008 missense possibly damaging 0.77
R2318:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2319:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2512:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2513:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2696:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2891:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2893:Plod3 UTSW 5 136988146 missense probably benign 0.38
R3030:Plod3 UTSW 5 136988146 missense probably benign 0.38
R3439:Plod3 UTSW 5 136988146 missense probably benign 0.38
R3957:Plod3 UTSW 5 136994192 missense probably damaging 1.00
R4080:Plod3 UTSW 5 136988146 missense probably benign 0.38
R4081:Plod3 UTSW 5 136988146 missense probably benign 0.38
R4342:Plod3 UTSW 5 136988146 missense probably benign 0.38
R4344:Plod3 UTSW 5 136988146 missense probably benign 0.38
R4345:Plod3 UTSW 5 136988146 missense probably benign 0.38
R4546:Plod3 UTSW 5 136988947 missense possibly damaging 0.94
R4799:Plod3 UTSW 5 136990800 missense probably benign 0.00
R4843:Plod3 UTSW 5 136991000 nonsense probably null
R4956:Plod3 UTSW 5 136989918 missense probably damaging 1.00
R5159:Plod3 UTSW 5 136995078 intron probably benign
R5162:Plod3 UTSW 5 136991307 missense probably damaging 1.00
R5328:Plod3 UTSW 5 136989683 missense probably damaging 1.00
R5427:Plod3 UTSW 5 136991788 missense probably damaging 1.00
R6627:Plod3 UTSW 5 136988456 missense probably damaging 0.99
R7003:Plod3 UTSW 5 136989644 missense probably damaging 1.00
R7132:Plod3 UTSW 5 136995117 missense
R7376:Plod3 UTSW 5 136990481 missense probably benign 0.00
R7404:Plod3 UTSW 5 136995047 missense probably benign
R7827:Plod3 UTSW 5 136989981 missense probably benign
R8062:Plod3 UTSW 5 136990269 missense possibly damaging 0.87
R8506:Plod3 UTSW 5 136988976 missense probably damaging 1.00
R8772:Plod3 UTSW 5 136988919 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAATGGAGCCTTAGGTGAGGACG -3'
(R):5'- GGCACCCTTTTCTGCTGGAAATGG -3'

Sequencing Primer
(F):5'- gagcacctgcctagaatcc -3'
(R):5'- TTTCTGCTGGAAATGGAGAAAACC -3'
Posted On2013-09-30