Incidental Mutation 'R9631:Dpp10'
ID 725474
Institutional Source Beutler Lab
Gene Symbol Dpp10
Ensembl Gene ENSMUSG00000036815
Gene Name dipeptidylpeptidase 10
Synonyms 6430601K09Rik, DPRP3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9631 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 123321471-124045559 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 123341703 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 659 (Y659C)
Ref Sequence ENSEMBL: ENSMUSP00000108225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112603] [ENSMUST00000112606]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000112603
AA Change: Y648C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108222
Gene: ENSMUSG00000036815
AA Change: Y648C

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
Pfam:DPPIV_N 83 450 4.9e-118 PFAM
Pfam:Peptidase_S9 530 734 6.4e-47 PFAM
Pfam:DLH 556 711 1.4e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112606
AA Change: Y659C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108225
Gene: ENSMUSG00000036815
AA Change: Y659C

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:DPPIV_N 137 504 4.4e-115 PFAM
Pfam:Peptidase_S9 584 788 8.6e-48 PFAM
Pfam:DLH 604 774 1.1e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Mutations in this gene have been associated with asthma. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A G 5: 30,482,185 D152G Het
Atl3 A G 19: 7,532,188 N427S probably benign Het
Bcar3 T A 3: 122,508,152 D165E possibly damaging Het
Brap T C 5: 121,684,372 I437T probably benign Het
Bspry T C 4: 62,482,718 probably null Het
Camkv G T 9: 107,945,791 V77L probably benign Het
Capn15 A T 17: 25,963,435 D566E probably damaging Het
Ccar2 A G 14: 70,151,895 V76A probably damaging Het
Ccdc142 T C 6: 83,107,161 C516R probably benign Het
Ccdc92b T A 11: 74,630,019 V49E Het
Ccr7 A G 11: 99,145,790 V102A probably benign Het
Cdh23 A T 10: 60,407,389 V1069E possibly damaging Het
Clpb T G 7: 101,785,398 V467G possibly damaging Het
Crebzf T A 7: 90,443,805 L264Q probably damaging Het
Ctif A G 18: 75,471,954 F505L probably benign Het
Cyp2j5 A G 4: 96,641,285 I283T probably benign Het
Ddx39 C A 8: 83,721,100 H191Q possibly damaging Het
Dnajc9 A T 14: 20,388,602 probably null Het
Dock7 A G 4: 98,966,323 L1568P unknown Het
Eef1akmt3 A G 10: 127,041,292 F35L probably benign Het
Etl4 A T 2: 20,661,938 N52I probably benign Het
F5 T A 1: 164,186,854 C565S probably damaging Het
Fam170b T C 14: 32,835,684 S159P probably damaging Het
Fitm2 A G 2: 163,469,837 I152T probably damaging Het
Fn1 T C 1: 71,586,228 D2473G probably benign Het
Fzd2 C A 11: 102,606,090 D453E probably benign Het
Grm5 T C 7: 87,975,352 Y376H probably damaging Het
H2-Q6 T A 17: 35,425,316 H91Q probably benign Het
Hspa4 A T 11: 53,269,755 V498E possibly damaging Het
Igsf10 A T 3: 59,330,483 L759H probably damaging Het
Jph1 T C 1: 17,091,383 T352A probably damaging Het
Kit C T 5: 75,607,029 T24M possibly damaging Het
Krtap28-13 T G 1: 83,061,176 C61G unknown Het
Lgr5 T A 10: 115,466,608 I293F probably damaging Het
Lyzl4 GGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAAGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAGGACACACTGCAGAGG GGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAGGACACACTGCAGAGG 9: 121,583,989 probably null Het
Mccc1 C A 3: 35,960,036 E711* probably null Het
Mroh2b C T 15: 4,917,074 T452I probably damaging Het
Ms4a10 G A 19: 10,967,087 T111I probably damaging Het
Myh11 A T 16: 14,207,577 V1443E Het
Oc90 A G 15: 65,897,780 L76P probably damaging Het
Olfr1223 T C 2: 89,145,178 probably benign Het
Olfr1308 A G 2: 111,961,032 F14L probably benign Het
Olfr1447 A G 19: 12,901,138 V214A possibly damaging Het
Olfr250 G A 9: 38,368,418 V281M possibly damaging Het
Olfr682-ps1 A T 7: 105,126,400 I290N probably damaging Het
Olfr958 G A 9: 39,550,212 R220* probably null Het
Olfr965 A T 9: 39,719,865 T213S possibly damaging Het
Olfr983 A G 9: 40,092,927 V13A probably damaging Het
Pgr C A 9: 8,900,846 Q127K probably benign Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rfc1 C T 5: 65,272,508 V852M probably damaging Het
Rin2 T A 2: 145,876,517 L639H probably damaging Het
Rpap2 T A 5: 107,620,426 W377R probably damaging Het
Senp7 T C 16: 56,155,268 S446P probably benign Het
Sipa1l1 A G 12: 82,341,002 M1V probably null Het
Slc25a36 A C 9: 97,100,100 S61A probably benign Het
Sptbn2 C T 19: 4,738,190 R1066W probably damaging Het
Tgm6 A G 2: 130,135,890 S50G probably benign Het
Thada T C 17: 84,231,156 S1475G probably benign Het
Tln1 G A 4: 43,545,694 A928V probably damaging Het
Trip11 G A 12: 101,893,548 L357F probably benign Het
Ttc3 G T 16: 94,370,722 probably benign Het
Ttc38 T C 15: 85,844,458 S204P possibly damaging Het
Vmn1r237 A T 17: 21,314,398 I128F probably benign Het
Vmn2r50 A T 7: 10,053,063 L39* probably null Het
Vps4b A G 1: 106,780,105 V216A possibly damaging Het
Zfp217 T C 2: 170,114,870 N736S possibly damaging Het
Zfp985 A G 4: 147,581,285 E25G probably damaging Het
Zfr C T 15: 12,154,542 R604* probably null Het
Zscan18 A G 7: 12,771,730 S577P possibly damaging Het
Other mutations in Dpp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Dpp10 APN 1 123334370 missense probably damaging 1.00
IGL01618:Dpp10 APN 1 123367867 missense probably benign
IGL02101:Dpp10 APN 1 123411826 missense probably damaging 1.00
IGL02284:Dpp10 APN 1 124045366 splice site probably benign
IGL02324:Dpp10 APN 1 123367802 missense probably benign 0.02
IGL02391:Dpp10 APN 1 123650358 missense probably damaging 0.98
IGL02458:Dpp10 APN 1 123341689 missense probably benign 0.01
IGL02469:Dpp10 APN 1 123411803 missense probably benign 0.01
IGL02501:Dpp10 APN 1 123686270 missense possibly damaging 0.93
IGL02522:Dpp10 APN 1 123423652 missense probably benign 0.24
IGL02672:Dpp10 APN 1 123376647 missense probably benign 0.45
IGL03034:Dpp10 APN 1 123341619 missense probably damaging 1.00
PIT1430001:Dpp10 UTSW 1 123341182 splice site probably benign
R0104:Dpp10 UTSW 1 123367843 missense probably benign 0.00
R0114:Dpp10 UTSW 1 123486092 missense probably benign 0.07
R0242:Dpp10 UTSW 1 123398546 missense possibly damaging 0.56
R0242:Dpp10 UTSW 1 123398546 missense possibly damaging 0.56
R0682:Dpp10 UTSW 1 123905125 missense probably damaging 0.98
R0815:Dpp10 UTSW 1 123432929 critical splice donor site probably null
R1549:Dpp10 UTSW 1 123341380 critical splice acceptor site probably null
R1742:Dpp10 UTSW 1 123445206 missense probably damaging 1.00
R1859:Dpp10 UTSW 1 123353604 missense possibly damaging 0.47
R1991:Dpp10 UTSW 1 123905106 missense probably null 1.00
R1992:Dpp10 UTSW 1 123905106 missense probably null 1.00
R2079:Dpp10 UTSW 1 123432992 missense probably damaging 1.00
R2882:Dpp10 UTSW 1 123445203 missense probably damaging 1.00
R2974:Dpp10 UTSW 1 123411705 splice site probably benign
R3827:Dpp10 UTSW 1 123411790 missense possibly damaging 0.56
R3852:Dpp10 UTSW 1 123485924 nonsense probably null
R3876:Dpp10 UTSW 1 123353487 missense probably damaging 0.98
R3899:Dpp10 UTSW 1 123353557 missense probably damaging 1.00
R4735:Dpp10 UTSW 1 123398627 missense probably benign 0.15
R4922:Dpp10 UTSW 1 123378153 missense probably benign 0.44
R5457:Dpp10 UTSW 1 123411810 missense possibly damaging 0.51
R5599:Dpp10 UTSW 1 123905076 missense probably damaging 0.99
R5913:Dpp10 UTSW 1 123384289 missense probably damaging 1.00
R5979:Dpp10 UTSW 1 123384283 critical splice donor site probably null
R6378:Dpp10 UTSW 1 123411739 missense probably damaging 1.00
R6429:Dpp10 UTSW 1 123367601 missense possibly damaging 0.72
R6505:Dpp10 UTSW 1 123336851 missense probably damaging 0.99
R6776:Dpp10 UTSW 1 123367656 nonsense probably null
R6894:Dpp10 UTSW 1 123336864 missense probably damaging 1.00
R6951:Dpp10 UTSW 1 123341650 missense possibly damaging 0.93
R7182:Dpp10 UTSW 1 123341151 missense probably benign 0.15
R7246:Dpp10 UTSW 1 123334377 missense probably damaging 1.00
R7297:Dpp10 UTSW 1 123353428 nonsense probably null
R7375:Dpp10 UTSW 1 123367795 missense probably benign
R7387:Dpp10 UTSW 1 123341140 missense probably benign 0.01
R7661:Dpp10 UTSW 1 123384952 missense probably damaging 1.00
R8065:Dpp10 UTSW 1 123352660 missense probably benign
R8067:Dpp10 UTSW 1 123352660 missense probably benign
R8260:Dpp10 UTSW 1 123686295 missense probably benign
R8324:Dpp10 UTSW 1 123854172 missense probably benign 0.02
R8373:Dpp10 UTSW 1 123854229 missense possibly damaging 0.94
R8434:Dpp10 UTSW 1 123433010 missense probably damaging 1.00
R9068:Dpp10 UTSW 1 123432938 missense probably damaging 1.00
R9104:Dpp10 UTSW 1 123411755 missense probably damaging 1.00
R9477:Dpp10 UTSW 1 123376641 missense possibly damaging 0.46
R9492:Dpp10 UTSW 1 123353430 missense probably damaging 1.00
R9524:Dpp10 UTSW 1 123336882 missense probably damaging 1.00
R9576:Dpp10 UTSW 1 123341680 missense probably damaging 1.00
R9736:Dpp10 UTSW 1 123334359 missense possibly damaging 0.64
X0019:Dpp10 UTSW 1 123398585 missense possibly damaging 0.88
X0020:Dpp10 UTSW 1 123398582 missense probably benign 0.36
X0021:Dpp10 UTSW 1 123432992 missense probably damaging 1.00
X0024:Dpp10 UTSW 1 123384286 missense probably damaging 1.00
Z1176:Dpp10 UTSW 1 123353440 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGCTCAATTGAGTTTCTCTGC -3'
(R):5'- TTTGGAGCAATTCTAGGATACATGG -3'

Sequencing Primer
(F):5'- AGCTCAATTGAGTTTCTCTGCATTGG -3'
(R):5'- GAGATATTGGAACATGTGCATT -3'
Posted On 2022-09-12