Incidental Mutation 'R9631:F5'
ID 725475
Institutional Source Beutler Lab
Gene Symbol F5
Ensembl Gene ENSMUSG00000026579
Gene Name coagulation factor V
Synonyms Cf-5, Cf5
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9631 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 163979407-164047846 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 164014423 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 565 (C565S)
Ref Sequence ENSEMBL: ENSMUSP00000083204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086040]
AlphaFold O88783
Predicted Effect probably damaging
Transcript: ENSMUST00000086040
AA Change: C565S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083204
Gene: ENSMUSG00000026579
AA Change: C565S

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Cu-oxidase_3 67 196 4.4e-10 PFAM
low complexity region 282 300 N/A INTRINSIC
Pfam:Cu-oxidase_3 397 527 1.5e-7 PFAM
low complexity region 1013 1019 N/A INTRINSIC
low complexity region 1045 1058 N/A INTRINSIC
low complexity region 1156 1173 N/A INTRINSIC
low complexity region 1352 1366 N/A INTRINSIC
low complexity region 1368 1382 N/A INTRINSIC
low complexity region 1440 1464 N/A INTRINSIC
Pfam:Cu-oxidase_3 1600 1714 9.1e-8 PFAM
FA58C 1865 2020 8.03e-36 SMART
FA58C 2024 2180 1.96e-30 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a glycoprotein coagulation factor that plays a critical role in the process of blood coagulation and hemostasis. The encoded protein is activated by thrombin, to generate a heterodimer containing heavy and light chains held together by calcium ions. About half of the mice lacking the encoded protein die at an embryonic stage possible due to abnormal yolk-sac vasculature while the remaining animals succumbed to massive hemorrhage immediately after birth. A point mutation in this gene has been shown to cause disseminated intravascular thrombosis in the perinatal period, resulting in frequent deaths of newborn mice. [provided by RefSeq, Apr 2015]
PHENOTYPE: Half of mice homozygous for a null allele die at E9-E10 with defects in yolk-sac vasculature and somite formation; the remaining half develop to term but die of massive hemorrhage within hours of birth. Mice homozygous for a knock-in (F5 Leiden) allele develop strain-specific perinatal thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atl3 A G 19: 7,509,553 (GRCm39) N427S probably benign Het
Bcar3 T A 3: 122,301,801 (GRCm39) D165E possibly damaging Het
Brap T C 5: 121,822,435 (GRCm39) I437T probably benign Het
Bspry T C 4: 62,400,955 (GRCm39) probably null Het
Camkv G T 9: 107,822,990 (GRCm39) V77L probably benign Het
Capn15 A T 17: 26,182,409 (GRCm39) D566E probably damaging Het
Ccar2 A G 14: 70,389,344 (GRCm39) V76A probably damaging Het
Ccdc142 T C 6: 83,084,142 (GRCm39) C516R probably benign Het
Ccdc92b T A 11: 74,520,845 (GRCm39) V49E Het
Ccr7 A G 11: 99,036,616 (GRCm39) V102A probably benign Het
Cdh23 A T 10: 60,243,168 (GRCm39) V1069E possibly damaging Het
Cimip2c A G 5: 30,639,529 (GRCm39) D152G Het
Clpb T G 7: 101,434,605 (GRCm39) V467G possibly damaging Het
Crebzf T A 7: 90,093,013 (GRCm39) L264Q probably damaging Het
Ctif A G 18: 75,605,025 (GRCm39) F505L probably benign Het
Cyp2j5 A G 4: 96,529,522 (GRCm39) I283T probably benign Het
Ddx39a C A 8: 84,447,729 (GRCm39) H191Q possibly damaging Het
Dnajc9 A T 14: 20,438,670 (GRCm39) probably null Het
Dock7 A G 4: 98,854,560 (GRCm39) L1568P unknown Het
Dpp10 T C 1: 123,269,432 (GRCm39) Y659C probably damaging Het
Eef1akmt3 A G 10: 126,877,161 (GRCm39) F35L probably benign Het
Etl4 A T 2: 20,666,749 (GRCm39) N52I probably benign Het
Fam170b T C 14: 32,557,641 (GRCm39) S159P probably damaging Het
Fitm2 A G 2: 163,311,757 (GRCm39) I152T probably damaging Het
Fn1 T C 1: 71,625,387 (GRCm39) D2473G probably benign Het
Fzd2 C A 11: 102,496,916 (GRCm39) D453E probably benign Het
Grm5 T C 7: 87,624,560 (GRCm39) Y376H probably damaging Het
H2-Q6 T A 17: 35,644,292 (GRCm39) H91Q probably benign Het
Hspa4 A T 11: 53,160,582 (GRCm39) V498E possibly damaging Het
Igsf10 A T 3: 59,237,904 (GRCm39) L759H probably damaging Het
Jph1 T C 1: 17,161,607 (GRCm39) T352A probably damaging Het
Kit C T 5: 75,767,689 (GRCm39) T24M possibly damaging Het
Krtap28-13 T G 1: 83,038,897 (GRCm39) C61G unknown Het
Lgr5 T A 10: 115,302,513 (GRCm39) I293F probably damaging Het
Lyzl4 GGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAAGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAGGACACACTGCAGAGG GGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAGGACACACTGCAGAGG 9: 121,413,055 (GRCm39) probably null Het
Mccc1 C A 3: 36,014,185 (GRCm39) E711* probably null Het
Mroh2b C T 15: 4,946,556 (GRCm39) T452I probably damaging Het
Ms4a10 G A 19: 10,944,451 (GRCm39) T111I probably damaging Het
Myh11 A T 16: 14,025,441 (GRCm39) V1443E Het
Oc90 A G 15: 65,769,629 (GRCm39) L76P probably damaging Het
Or10d3 G A 9: 39,461,508 (GRCm39) R220* probably null Het
Or4c118 T C 2: 88,975,522 (GRCm39) probably benign Het
Or4f57 A G 2: 111,791,377 (GRCm39) F14L probably benign Het
Or56a42-ps1 A T 7: 104,775,607 (GRCm39) I290N probably damaging Het
Or5b97 A G 19: 12,878,502 (GRCm39) V214A possibly damaging Het
Or8b57 A G 9: 40,004,223 (GRCm39) V13A probably damaging Het
Or8c10 G A 9: 38,279,714 (GRCm39) V281M possibly damaging Het
Or8g52 A T 9: 39,631,161 (GRCm39) T213S possibly damaging Het
Pgr C A 9: 8,900,847 (GRCm39) Q127K probably benign Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,348,367 (GRCm39) probably benign Het
Rfc1 C T 5: 65,429,851 (GRCm39) V852M probably damaging Het
Rin2 T A 2: 145,718,437 (GRCm39) L639H probably damaging Het
Rpap2 T A 5: 107,768,292 (GRCm39) W377R probably damaging Het
Senp7 T C 16: 55,975,631 (GRCm39) S446P probably benign Het
Sipa1l1 A G 12: 82,387,776 (GRCm39) M1V probably null Het
Slc25a36 A C 9: 96,982,153 (GRCm39) S61A probably benign Het
Sptbn2 C T 19: 4,788,218 (GRCm39) R1066W probably damaging Het
Tgm6 A G 2: 129,977,810 (GRCm39) S50G probably benign Het
Thada T C 17: 84,538,584 (GRCm39) S1475G probably benign Het
Tln1 G A 4: 43,545,694 (GRCm39) A928V probably damaging Het
Trip11 G A 12: 101,859,807 (GRCm39) L357F probably benign Het
Ttc3 G T 16: 94,171,581 (GRCm39) probably benign Het
Ttc38 T C 15: 85,728,659 (GRCm39) S204P possibly damaging Het
Vmn1r237 A T 17: 21,534,660 (GRCm39) I128F probably benign Het
Vmn2r50 A T 7: 9,786,990 (GRCm39) L39* probably null Het
Vps4b A G 1: 106,707,835 (GRCm39) V216A possibly damaging Het
Zfp217 T C 2: 169,956,790 (GRCm39) N736S possibly damaging Het
Zfp985 A G 4: 147,665,742 (GRCm39) E25G probably damaging Het
Zfr C T 15: 12,154,628 (GRCm39) R604* probably null Het
Zscan18 A G 7: 12,505,657 (GRCm39) S577P possibly damaging Het
Other mutations in F5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:F5 APN 1 164,007,093 (GRCm39) missense probably benign 0.15
IGL00843:F5 APN 1 164,039,360 (GRCm39) missense probably benign 0.00
IGL00904:F5 APN 1 164,021,578 (GRCm39) missense probably benign
IGL00913:F5 APN 1 164,032,465 (GRCm39) missense probably damaging 1.00
IGL01099:F5 APN 1 164,021,903 (GRCm39) missense probably damaging 0.99
IGL01134:F5 APN 1 164,019,548 (GRCm39) missense possibly damaging 0.87
IGL01313:F5 APN 1 164,021,181 (GRCm39) missense probably benign 0.01
IGL01635:F5 APN 1 164,035,427 (GRCm39) missense probably benign 0.00
IGL01697:F5 APN 1 164,021,621 (GRCm39) missense probably benign 0.04
IGL01768:F5 APN 1 164,003,914 (GRCm39) missense probably benign 0.22
IGL01795:F5 APN 1 164,021,959 (GRCm39) missense probably benign 0.00
IGL01835:F5 APN 1 164,021,937 (GRCm39) missense probably benign 0.12
IGL01843:F5 APN 1 164,039,395 (GRCm39) missense probably benign 0.05
IGL01989:F5 APN 1 164,003,876 (GRCm39) missense probably benign 0.39
IGL02036:F5 APN 1 164,010,571 (GRCm39) splice site probably benign
IGL02065:F5 APN 1 164,017,695 (GRCm39) missense probably damaging 1.00
IGL02077:F5 APN 1 164,026,435 (GRCm39) missense probably damaging 1.00
IGL02139:F5 APN 1 164,020,243 (GRCm39) missense possibly damaging 0.89
IGL02210:F5 APN 1 164,017,710 (GRCm39) missense probably benign 0.00
IGL02415:F5 APN 1 164,019,498 (GRCm39) missense probably damaging 1.00
IGL02440:F5 APN 1 164,034,635 (GRCm39) missense possibly damaging 0.79
IGL02471:F5 APN 1 164,001,860 (GRCm39) missense probably damaging 1.00
IGL02535:F5 APN 1 164,026,302 (GRCm39) missense probably damaging 0.98
IGL02537:F5 APN 1 164,020,686 (GRCm39) missense probably benign 0.26
IGL02628:F5 APN 1 164,021,644 (GRCm39) missense probably damaging 0.99
IGL02638:F5 APN 1 164,012,177 (GRCm39) critical splice donor site probably null
IGL02824:F5 APN 1 164,021,916 (GRCm39) missense probably benign 0.00
IGL02977:F5 APN 1 164,021,590 (GRCm39) missense probably damaging 1.00
IGL03028:F5 APN 1 164,020,569 (GRCm39) nonsense probably null
IGL03064:F5 APN 1 164,023,163 (GRCm39) missense probably benign 0.04
IGL03127:F5 APN 1 164,021,107 (GRCm39) missense probably benign 0.45
IGL03131:F5 APN 1 163,989,388 (GRCm39) missense possibly damaging 0.62
IGL03348:F5 APN 1 164,021,721 (GRCm39) missense possibly damaging 0.49
IGL03387:F5 APN 1 164,020,801 (GRCm39) missense probably damaging 1.00
James_dean UTSW 1 164,032,389 (GRCm39) missense probably benign 0.43
BB002:F5 UTSW 1 164,003,935 (GRCm39) critical splice donor site probably null
BB012:F5 UTSW 1 164,003,935 (GRCm39) critical splice donor site probably null
R0002:F5 UTSW 1 164,029,200 (GRCm39) missense probably damaging 1.00
R0095:F5 UTSW 1 164,019,537 (GRCm39) nonsense probably null
R0116:F5 UTSW 1 164,012,483 (GRCm39) missense probably benign 0.01
R0359:F5 UTSW 1 164,007,018 (GRCm39) missense probably damaging 1.00
R0426:F5 UTSW 1 164,010,409 (GRCm39) missense probably damaging 0.99
R0452:F5 UTSW 1 164,012,676 (GRCm39) missense probably damaging 0.99
R0457:F5 UTSW 1 164,021,769 (GRCm39) missense probably benign 0.00
R0520:F5 UTSW 1 164,037,156 (GRCm39) missense probably benign 0.15
R0522:F5 UTSW 1 164,039,332 (GRCm39) missense probably damaging 1.00
R0554:F5 UTSW 1 164,007,018 (GRCm39) missense probably damaging 1.00
R0575:F5 UTSW 1 164,003,813 (GRCm39) missense probably damaging 1.00
R0734:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R0739:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1062:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1063:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1149:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1149:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1150:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1151:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1152:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1221:F5 UTSW 1 163,989,368 (GRCm39) missense probably damaging 1.00
R1284:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1286:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1358:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1360:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1362:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1383:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1465:F5 UTSW 1 164,026,402 (GRCm39) missense probably benign 0.02
R1465:F5 UTSW 1 164,026,402 (GRCm39) missense probably benign 0.02
R1545:F5 UTSW 1 164,036,529 (GRCm39) nonsense probably null
R1561:F5 UTSW 1 164,014,472 (GRCm39) nonsense probably null
R1623:F5 UTSW 1 164,023,191 (GRCm39) missense probably damaging 1.00
R1662:F5 UTSW 1 164,035,457 (GRCm39) missense probably damaging 1.00
R1673:F5 UTSW 1 164,007,089 (GRCm39) missense probably damaging 1.00
R1689:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1705:F5 UTSW 1 164,045,059 (GRCm39) missense possibly damaging 0.92
R1732:F5 UTSW 1 164,001,719 (GRCm39) missense probably damaging 1.00
R1763:F5 UTSW 1 164,020,104 (GRCm39) missense probably benign 0.04
R1774:F5 UTSW 1 164,020,104 (GRCm39) missense probably benign 0.04
R1799:F5 UTSW 1 164,021,100 (GRCm39) missense possibly damaging 0.58
R1800:F5 UTSW 1 164,010,403 (GRCm39) missense probably damaging 1.00
R1842:F5 UTSW 1 164,012,129 (GRCm39) missense probably damaging 0.99
R1915:F5 UTSW 1 164,010,486 (GRCm39) missense probably damaging 0.97
R1926:F5 UTSW 1 164,007,077 (GRCm39) missense probably damaging 1.00
R2025:F5 UTSW 1 164,037,044 (GRCm39) missense probably benign 0.05
R2198:F5 UTSW 1 164,034,603 (GRCm39) missense probably damaging 1.00
R2258:F5 UTSW 1 164,019,750 (GRCm39) missense probably damaging 1.00
R2264:F5 UTSW 1 164,021,971 (GRCm39) missense probably benign 0.32
R2281:F5 UTSW 1 164,023,289 (GRCm39) missense possibly damaging 0.80
R2407:F5 UTSW 1 164,039,441 (GRCm39) missense probably damaging 1.00
R2445:F5 UTSW 1 164,017,795 (GRCm39) missense probably damaging 1.00
R2860:F5 UTSW 1 164,012,533 (GRCm39) missense probably damaging 1.00
R2861:F5 UTSW 1 164,012,533 (GRCm39) missense probably damaging 1.00
R2862:F5 UTSW 1 164,012,533 (GRCm39) missense probably damaging 1.00
R2899:F5 UTSW 1 164,014,469 (GRCm39) missense possibly damaging 0.88
R2910:F5 UTSW 1 164,032,389 (GRCm39) missense probably benign 0.43
R2912:F5 UTSW 1 164,021,488 (GRCm39) missense probably damaging 0.98
R2996:F5 UTSW 1 164,010,486 (GRCm39) missense probably damaging 0.97
R3745:F5 UTSW 1 164,014,348 (GRCm39) missense possibly damaging 0.79
R3901:F5 UTSW 1 164,003,798 (GRCm39) missense probably benign 0.08
R3902:F5 UTSW 1 164,003,798 (GRCm39) missense probably benign 0.08
R4365:F5 UTSW 1 164,012,519 (GRCm39) missense probably damaging 0.98
R4448:F5 UTSW 1 164,026,468 (GRCm39) missense possibly damaging 0.52
R4490:F5 UTSW 1 164,044,964 (GRCm39) missense probably benign 0.40
R4514:F5 UTSW 1 163,979,566 (GRCm39) unclassified probably benign
R4598:F5 UTSW 1 164,032,366 (GRCm39) missense probably benign 0.05
R4608:F5 UTSW 1 164,036,598 (GRCm39) missense probably benign 0.12
R4661:F5 UTSW 1 164,012,489 (GRCm39) missense probably damaging 1.00
R4667:F5 UTSW 1 164,001,755 (GRCm39) missense probably benign 0.00
R4689:F5 UTSW 1 163,979,542 (GRCm39) unclassified probably benign
R4716:F5 UTSW 1 164,021,488 (GRCm39) missense probably damaging 0.98
R4732:F5 UTSW 1 164,009,226 (GRCm39) missense probably damaging 1.00
R4733:F5 UTSW 1 164,009,226 (GRCm39) missense probably damaging 1.00
R4854:F5 UTSW 1 164,019,715 (GRCm39) missense probably damaging 1.00
R4908:F5 UTSW 1 164,039,389 (GRCm39) missense probably damaging 1.00
R4971:F5 UTSW 1 164,021,755 (GRCm39) missense probably benign
R5001:F5 UTSW 1 164,023,139 (GRCm39) missense probably benign 0.00
R5042:F5 UTSW 1 164,047,020 (GRCm39) missense probably damaging 1.00
R5056:F5 UTSW 1 164,019,601 (GRCm39) missense possibly damaging 0.60
R5061:F5 UTSW 1 164,021,749 (GRCm39) missense probably benign 0.00
R5143:F5 UTSW 1 164,039,397 (GRCm39) missense probably damaging 0.98
R5622:F5 UTSW 1 164,020,134 (GRCm39) missense probably benign 0.09
R5626:F5 UTSW 1 164,036,604 (GRCm39) missense probably damaging 0.98
R5658:F5 UTSW 1 164,019,907 (GRCm39) missense probably damaging 0.96
R5702:F5 UTSW 1 164,022,116 (GRCm39) nonsense probably null
R5795:F5 UTSW 1 163,979,578 (GRCm39) missense probably benign 0.09
R5884:F5 UTSW 1 164,023,215 (GRCm39) missense probably benign 0.01
R6036:F5 UTSW 1 164,012,565 (GRCm39) missense probably damaging 0.99
R6036:F5 UTSW 1 164,012,565 (GRCm39) missense probably damaging 0.99
R6151:F5 UTSW 1 164,009,204 (GRCm39) missense probably damaging 1.00
R6151:F5 UTSW 1 164,017,756 (GRCm39) missense probably damaging 1.00
R6345:F5 UTSW 1 164,019,520 (GRCm39) missense probably benign 0.13
R6391:F5 UTSW 1 164,021,062 (GRCm39) missense probably damaging 0.99
R6542:F5 UTSW 1 164,022,037 (GRCm39) missense probably benign 0.32
R6620:F5 UTSW 1 164,014,375 (GRCm39) missense probably damaging 1.00
R6750:F5 UTSW 1 164,021,076 (GRCm39) missense possibly damaging 0.58
R6754:F5 UTSW 1 164,021,332 (GRCm39) missense probably damaging 1.00
R6774:F5 UTSW 1 164,014,447 (GRCm39) missense probably damaging 1.00
R6802:F5 UTSW 1 164,006,925 (GRCm39) missense probably damaging 0.98
R6810:F5 UTSW 1 164,014,471 (GRCm39) missense probably damaging 1.00
R6983:F5 UTSW 1 164,021,698 (GRCm39) missense probably damaging 1.00
R7000:F5 UTSW 1 164,007,075 (GRCm39) missense probably damaging 1.00
R7151:F5 UTSW 1 164,029,230 (GRCm39) missense probably damaging 1.00
R7193:F5 UTSW 1 164,046,966 (GRCm39) missense probably damaging 1.00
R7230:F5 UTSW 1 164,012,522 (GRCm39) missense probably benign
R7324:F5 UTSW 1 164,021,150 (GRCm39) small deletion probably benign
R7350:F5 UTSW 1 164,020,277 (GRCm39) missense probably benign 0.08
R7466:F5 UTSW 1 164,020,897 (GRCm39) missense possibly damaging 0.61
R7503:F5 UTSW 1 164,019,779 (GRCm39) missense probably damaging 1.00
R7626:F5 UTSW 1 164,014,481 (GRCm39) missense possibly damaging 0.95
R7742:F5 UTSW 1 164,035,453 (GRCm39) missense possibly damaging 0.51
R7837:F5 UTSW 1 164,014,363 (GRCm39) missense probably damaging 1.00
R7848:F5 UTSW 1 163,989,446 (GRCm39) missense possibly damaging 0.94
R7925:F5 UTSW 1 164,003,935 (GRCm39) critical splice donor site probably null
R8053:F5 UTSW 1 164,020,338 (GRCm39) missense probably benign 0.26
R8094:F5 UTSW 1 164,036,509 (GRCm39) missense probably benign 0.06
R8175:F5 UTSW 1 164,019,834 (GRCm39) nonsense probably null
R8209:F5 UTSW 1 164,021,959 (GRCm39) missense probably benign 0.00
R8226:F5 UTSW 1 164,021,959 (GRCm39) missense probably benign 0.00
R8266:F5 UTSW 1 164,012,693 (GRCm39) critical splice donor site probably null
R8517:F5 UTSW 1 164,003,822 (GRCm39) missense probably damaging 0.99
R8684:F5 UTSW 1 164,045,111 (GRCm39) missense probably benign 0.01
R8941:F5 UTSW 1 164,026,440 (GRCm39) missense probably benign 0.19
R9130:F5 UTSW 1 164,001,830 (GRCm39) missense probably benign 0.37
R9181:F5 UTSW 1 164,019,895 (GRCm39) missense probably benign 0.00
R9186:F5 UTSW 1 164,021,470 (GRCm39) missense probably benign
R9233:F5 UTSW 1 164,047,020 (GRCm39) missense probably damaging 1.00
R9314:F5 UTSW 1 164,029,146 (GRCm39) missense probably benign 0.01
R9655:F5 UTSW 1 164,021,730 (GRCm39) missense probably benign 0.15
X0024:F5 UTSW 1 164,020,557 (GRCm39) missense probably damaging 1.00
Z1088:F5 UTSW 1 163,981,954 (GRCm39) missense probably benign 0.04
Z1176:F5 UTSW 1 164,012,085 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AATCATGGCCTCCTAGGTGC -3'
(R):5'- ATCAATAAGTCCTAGAGCTGTGAG -3'

Sequencing Primer
(F):5'- TGCCAGACACGTGGCTC -3'
(R):5'- TAAGTCCTAGAGCTGTGAGTGAGG -3'
Posted On 2022-09-12