Incidental Mutation 'R9631:Or4f57'
ID 725478
Institutional Source Beutler Lab
Gene Symbol Or4f57
Ensembl Gene ENSMUSG00000074952
Gene Name olfactory receptor family 4 subfamily F member 57
Synonyms MOR245-22, Olfr1308, GA_x6K02T2Q125-73008844-73007882
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R9631 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 111790454-111791416 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111791377 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 14 (F14L)
Ref Sequence ENSEMBL: ENSMUSP00000146688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099605] [ENSMUST00000207560]
AlphaFold Q7TQX0
Predicted Effect probably benign
Transcript: ENSMUST00000099605
AA Change: F14L

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097200
Gene: ENSMUSG00000074952
AA Change: F14L

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 2.2e-39 PFAM
Pfam:7tm_1 41 287 3.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207560
AA Change: F14L

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atl3 A G 19: 7,509,553 (GRCm39) N427S probably benign Het
Bcar3 T A 3: 122,301,801 (GRCm39) D165E possibly damaging Het
Brap T C 5: 121,822,435 (GRCm39) I437T probably benign Het
Bspry T C 4: 62,400,955 (GRCm39) probably null Het
Camkv G T 9: 107,822,990 (GRCm39) V77L probably benign Het
Capn15 A T 17: 26,182,409 (GRCm39) D566E probably damaging Het
Ccar2 A G 14: 70,389,344 (GRCm39) V76A probably damaging Het
Ccdc142 T C 6: 83,084,142 (GRCm39) C516R probably benign Het
Ccdc92b T A 11: 74,520,845 (GRCm39) V49E Het
Ccr7 A G 11: 99,036,616 (GRCm39) V102A probably benign Het
Cdh23 A T 10: 60,243,168 (GRCm39) V1069E possibly damaging Het
Cimip2c A G 5: 30,639,529 (GRCm39) D152G Het
Clpb T G 7: 101,434,605 (GRCm39) V467G possibly damaging Het
Crebzf T A 7: 90,093,013 (GRCm39) L264Q probably damaging Het
Ctif A G 18: 75,605,025 (GRCm39) F505L probably benign Het
Cyp2j5 A G 4: 96,529,522 (GRCm39) I283T probably benign Het
Ddx39a C A 8: 84,447,729 (GRCm39) H191Q possibly damaging Het
Dnajc9 A T 14: 20,438,670 (GRCm39) probably null Het
Dock7 A G 4: 98,854,560 (GRCm39) L1568P unknown Het
Dpp10 T C 1: 123,269,432 (GRCm39) Y659C probably damaging Het
Eef1akmt3 A G 10: 126,877,161 (GRCm39) F35L probably benign Het
Etl4 A T 2: 20,666,749 (GRCm39) N52I probably benign Het
F5 T A 1: 164,014,423 (GRCm39) C565S probably damaging Het
Fam170b T C 14: 32,557,641 (GRCm39) S159P probably damaging Het
Fitm2 A G 2: 163,311,757 (GRCm39) I152T probably damaging Het
Fn1 T C 1: 71,625,387 (GRCm39) D2473G probably benign Het
Fzd2 C A 11: 102,496,916 (GRCm39) D453E probably benign Het
Grm5 T C 7: 87,624,560 (GRCm39) Y376H probably damaging Het
H2-Q6 T A 17: 35,644,292 (GRCm39) H91Q probably benign Het
Hspa4 A T 11: 53,160,582 (GRCm39) V498E possibly damaging Het
Igsf10 A T 3: 59,237,904 (GRCm39) L759H probably damaging Het
Jph1 T C 1: 17,161,607 (GRCm39) T352A probably damaging Het
Kit C T 5: 75,767,689 (GRCm39) T24M possibly damaging Het
Krtap28-13 T G 1: 83,038,897 (GRCm39) C61G unknown Het
Lgr5 T A 10: 115,302,513 (GRCm39) I293F probably damaging Het
Lyzl4 GGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAAGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAGGACACACTGCAGAGG GGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAGGACACACTGCAGAGG 9: 121,413,055 (GRCm39) probably null Het
Mccc1 C A 3: 36,014,185 (GRCm39) E711* probably null Het
Mroh2b C T 15: 4,946,556 (GRCm39) T452I probably damaging Het
Ms4a10 G A 19: 10,944,451 (GRCm39) T111I probably damaging Het
Myh11 A T 16: 14,025,441 (GRCm39) V1443E Het
Oc90 A G 15: 65,769,629 (GRCm39) L76P probably damaging Het
Or10d3 G A 9: 39,461,508 (GRCm39) R220* probably null Het
Or4c118 T C 2: 88,975,522 (GRCm39) probably benign Het
Or56a42-ps1 A T 7: 104,775,607 (GRCm39) I290N probably damaging Het
Or5b97 A G 19: 12,878,502 (GRCm39) V214A possibly damaging Het
Or8b57 A G 9: 40,004,223 (GRCm39) V13A probably damaging Het
Or8c10 G A 9: 38,279,714 (GRCm39) V281M possibly damaging Het
Or8g52 A T 9: 39,631,161 (GRCm39) T213S possibly damaging Het
Pgr C A 9: 8,900,847 (GRCm39) Q127K probably benign Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,348,367 (GRCm39) probably benign Het
Rfc1 C T 5: 65,429,851 (GRCm39) V852M probably damaging Het
Rin2 T A 2: 145,718,437 (GRCm39) L639H probably damaging Het
Rpap2 T A 5: 107,768,292 (GRCm39) W377R probably damaging Het
Senp7 T C 16: 55,975,631 (GRCm39) S446P probably benign Het
Sipa1l1 A G 12: 82,387,776 (GRCm39) M1V probably null Het
Slc25a36 A C 9: 96,982,153 (GRCm39) S61A probably benign Het
Sptbn2 C T 19: 4,788,218 (GRCm39) R1066W probably damaging Het
Tgm6 A G 2: 129,977,810 (GRCm39) S50G probably benign Het
Thada T C 17: 84,538,584 (GRCm39) S1475G probably benign Het
Tln1 G A 4: 43,545,694 (GRCm39) A928V probably damaging Het
Trip11 G A 12: 101,859,807 (GRCm39) L357F probably benign Het
Ttc3 G T 16: 94,171,581 (GRCm39) probably benign Het
Ttc38 T C 15: 85,728,659 (GRCm39) S204P possibly damaging Het
Vmn1r237 A T 17: 21,534,660 (GRCm39) I128F probably benign Het
Vmn2r50 A T 7: 9,786,990 (GRCm39) L39* probably null Het
Vps4b A G 1: 106,707,835 (GRCm39) V216A possibly damaging Het
Zfp217 T C 2: 169,956,790 (GRCm39) N736S possibly damaging Het
Zfp985 A G 4: 147,665,742 (GRCm39) E25G probably damaging Het
Zfr C T 15: 12,154,628 (GRCm39) R604* probably null Het
Zscan18 A G 7: 12,505,657 (GRCm39) S577P possibly damaging Het
Other mutations in Or4f57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Or4f57 APN 2 111,790,620 (GRCm39) missense possibly damaging 0.84
IGL01359:Or4f57 APN 2 111,791,406 (GRCm39) missense probably benign
IGL01731:Or4f57 APN 2 111,790,980 (GRCm39) missense probably benign 0.03
IGL01788:Or4f57 APN 2 111,791,352 (GRCm39) missense probably benign
IGL02385:Or4f57 APN 2 111,790,603 (GRCm39) missense probably benign 0.00
IGL02969:Or4f57 APN 2 111,790,912 (GRCm39) missense probably damaging 1.00
R0102:Or4f57 UTSW 2 111,790,942 (GRCm39) missense probably damaging 1.00
R0102:Or4f57 UTSW 2 111,790,942 (GRCm39) missense probably damaging 1.00
R0244:Or4f57 UTSW 2 111,791,361 (GRCm39) missense probably benign 0.13
R0265:Or4f57 UTSW 2 111,790,839 (GRCm39) missense probably damaging 0.99
R1268:Or4f57 UTSW 2 111,791,222 (GRCm39) missense possibly damaging 0.78
R1406:Or4f57 UTSW 2 111,790,926 (GRCm39) missense probably benign 0.07
R1406:Or4f57 UTSW 2 111,790,926 (GRCm39) missense probably benign 0.07
R1568:Or4f57 UTSW 2 111,790,585 (GRCm39) missense probably benign 0.02
R2401:Or4f57 UTSW 2 111,790,494 (GRCm39) missense probably benign 0.01
R4396:Or4f57 UTSW 2 111,790,560 (GRCm39) missense probably damaging 1.00
R4528:Or4f57 UTSW 2 111,791,293 (GRCm39) missense probably damaging 1.00
R5916:Or4f57 UTSW 2 111,791,175 (GRCm39) missense probably damaging 1.00
R6332:Or4f57 UTSW 2 111,791,091 (GRCm39) missense probably damaging 0.98
R6595:Or4f57 UTSW 2 111,790,515 (GRCm39) missense possibly damaging 0.95
R7339:Or4f57 UTSW 2 111,790,956 (GRCm39) missense probably benign 0.12
R7917:Or4f57 UTSW 2 111,791,310 (GRCm39) missense probably damaging 0.98
R8017:Or4f57 UTSW 2 111,790,918 (GRCm39) missense probably damaging 0.99
R8092:Or4f57 UTSW 2 111,790,652 (GRCm39) missense probably benign 0.00
R8246:Or4f57 UTSW 2 111,790,483 (GRCm39) missense probably benign 0.05
R9389:Or4f57 UTSW 2 111,790,872 (GRCm39) missense probably damaging 1.00
R9515:Or4f57 UTSW 2 111,790,584 (GRCm39) missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- AGAAGATTTGAGTGACACAACCTC -3'
(R):5'- TGTTTGGAACTTGCTCACATC -3'

Sequencing Primer
(F):5'- AGATCATAAATCATCTTGGGGGC -3'
(R):5'- GAACTTGCTCACATCTTTGTATTCAG -3'
Posted On 2022-09-12