Incidental Mutation 'R9631:Olfr1308'
ID 725478
Institutional Source Beutler Lab
Gene Symbol Olfr1308
Ensembl Gene ENSMUSG00000074952
Gene Name olfactory receptor 1308
Synonyms MOR245-22, GA_x6K02T2Q125-73008844-73007882
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R9631 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 111959285-111964944 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111961032 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 14 (F14L)
Ref Sequence ENSEMBL: ENSMUSP00000146688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099605] [ENSMUST00000207560]
AlphaFold Q7TQX0
Predicted Effect probably benign
Transcript: ENSMUST00000099605
AA Change: F14L

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097200
Gene: ENSMUSG00000074952
AA Change: F14L

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 2.2e-39 PFAM
Pfam:7tm_1 41 287 3.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207560
AA Change: F14L

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A G 5: 30,482,185 D152G Het
Atl3 A G 19: 7,532,188 N427S probably benign Het
Bcar3 T A 3: 122,508,152 D165E possibly damaging Het
Brap T C 5: 121,684,372 I437T probably benign Het
Bspry T C 4: 62,482,718 probably null Het
Camkv G T 9: 107,945,791 V77L probably benign Het
Capn15 A T 17: 25,963,435 D566E probably damaging Het
Ccar2 A G 14: 70,151,895 V76A probably damaging Het
Ccdc142 T C 6: 83,107,161 C516R probably benign Het
Ccdc92b T A 11: 74,630,019 V49E Het
Ccr7 A G 11: 99,145,790 V102A probably benign Het
Cdh23 A T 10: 60,407,389 V1069E possibly damaging Het
Clpb T G 7: 101,785,398 V467G possibly damaging Het
Crebzf T A 7: 90,443,805 L264Q probably damaging Het
Ctif A G 18: 75,471,954 F505L probably benign Het
Cyp2j5 A G 4: 96,641,285 I283T probably benign Het
Ddx39 C A 8: 83,721,100 H191Q possibly damaging Het
Dnajc9 A T 14: 20,388,602 probably null Het
Dock7 A G 4: 98,966,323 L1568P unknown Het
Dpp10 T C 1: 123,341,703 Y659C probably damaging Het
Eef1akmt3 A G 10: 127,041,292 F35L probably benign Het
Etl4 A T 2: 20,661,938 N52I probably benign Het
F5 T A 1: 164,186,854 C565S probably damaging Het
Fam170b T C 14: 32,835,684 S159P probably damaging Het
Fitm2 A G 2: 163,469,837 I152T probably damaging Het
Fn1 T C 1: 71,586,228 D2473G probably benign Het
Fzd2 C A 11: 102,606,090 D453E probably benign Het
Grm5 T C 7: 87,975,352 Y376H probably damaging Het
H2-Q6 T A 17: 35,425,316 H91Q probably benign Het
Hspa4 A T 11: 53,269,755 V498E possibly damaging Het
Igsf10 A T 3: 59,330,483 L759H probably damaging Het
Jph1 T C 1: 17,091,383 T352A probably damaging Het
Kit C T 5: 75,607,029 T24M possibly damaging Het
Krtap28-13 T G 1: 83,061,176 C61G unknown Het
Lgr5 T A 10: 115,466,608 I293F probably damaging Het
Lyzl4 GGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAAGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAGGACACACTGCAGAGG GGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAGGACACACTGCAGAGG 9: 121,583,989 probably null Het
Mccc1 C A 3: 35,960,036 E711* probably null Het
Mroh2b C T 15: 4,917,074 T452I probably damaging Het
Ms4a10 G A 19: 10,967,087 T111I probably damaging Het
Myh11 A T 16: 14,207,577 V1443E Het
Oc90 A G 15: 65,897,780 L76P probably damaging Het
Olfr1223 T C 2: 89,145,178 probably benign Het
Olfr1447 A G 19: 12,901,138 V214A possibly damaging Het
Olfr250 G A 9: 38,368,418 V281M possibly damaging Het
Olfr682-ps1 A T 7: 105,126,400 I290N probably damaging Het
Olfr958 G A 9: 39,550,212 R220* probably null Het
Olfr965 A T 9: 39,719,865 T213S possibly damaging Het
Olfr983 A G 9: 40,092,927 V13A probably damaging Het
Pgr C A 9: 8,900,846 Q127K probably benign Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rfc1 C T 5: 65,272,508 V852M probably damaging Het
Rin2 T A 2: 145,876,517 L639H probably damaging Het
Rpap2 T A 5: 107,620,426 W377R probably damaging Het
Senp7 T C 16: 56,155,268 S446P probably benign Het
Sipa1l1 A G 12: 82,341,002 M1V probably null Het
Slc25a36 A C 9: 97,100,100 S61A probably benign Het
Sptbn2 C T 19: 4,738,190 R1066W probably damaging Het
Tgm6 A G 2: 130,135,890 S50G probably benign Het
Thada T C 17: 84,231,156 S1475G probably benign Het
Tln1 G A 4: 43,545,694 A928V probably damaging Het
Trip11 G A 12: 101,893,548 L357F probably benign Het
Ttc3 G T 16: 94,370,722 probably benign Het
Ttc38 T C 15: 85,844,458 S204P possibly damaging Het
Vmn1r237 A T 17: 21,314,398 I128F probably benign Het
Vmn2r50 A T 7: 10,053,063 L39* probably null Het
Vps4b A G 1: 106,780,105 V216A possibly damaging Het
Zfp217 T C 2: 170,114,870 N736S possibly damaging Het
Zfp985 A G 4: 147,581,285 E25G probably damaging Het
Zfr C T 15: 12,154,542 R604* probably null Het
Zscan18 A G 7: 12,771,730 S577P possibly damaging Het
Other mutations in Olfr1308
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Olfr1308 APN 2 111960275 missense possibly damaging 0.84
IGL01359:Olfr1308 APN 2 111961061 missense probably benign
IGL01731:Olfr1308 APN 2 111960635 missense probably benign 0.03
IGL01788:Olfr1308 APN 2 111961007 missense probably benign
IGL02385:Olfr1308 APN 2 111960258 missense probably benign 0.00
IGL02969:Olfr1308 APN 2 111960567 missense probably damaging 1.00
R0102:Olfr1308 UTSW 2 111960597 missense probably damaging 1.00
R0102:Olfr1308 UTSW 2 111960597 missense probably damaging 1.00
R0244:Olfr1308 UTSW 2 111961016 missense probably benign 0.13
R0265:Olfr1308 UTSW 2 111960494 missense probably damaging 0.99
R1268:Olfr1308 UTSW 2 111960877 missense possibly damaging 0.78
R1406:Olfr1308 UTSW 2 111960581 missense probably benign 0.07
R1406:Olfr1308 UTSW 2 111960581 missense probably benign 0.07
R1568:Olfr1308 UTSW 2 111960240 missense probably benign 0.02
R2401:Olfr1308 UTSW 2 111960149 missense probably benign 0.01
R4396:Olfr1308 UTSW 2 111960215 missense probably damaging 1.00
R4528:Olfr1308 UTSW 2 111960948 missense probably damaging 1.00
R5916:Olfr1308 UTSW 2 111960830 missense probably damaging 1.00
R6332:Olfr1308 UTSW 2 111960746 missense probably damaging 0.98
R6595:Olfr1308 UTSW 2 111960170 missense possibly damaging 0.95
R7339:Olfr1308 UTSW 2 111960611 missense probably benign 0.12
R7917:Olfr1308 UTSW 2 111960965 missense probably damaging 0.98
R8017:Olfr1308 UTSW 2 111960573 missense probably damaging 0.99
R8092:Olfr1308 UTSW 2 111960307 missense probably benign 0.00
R8246:Olfr1308 UTSW 2 111960138 missense probably benign 0.05
R9389:Olfr1308 UTSW 2 111960527 missense probably damaging 1.00
R9515:Olfr1308 UTSW 2 111960239 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- AGAAGATTTGAGTGACACAACCTC -3'
(R):5'- TGTTTGGAACTTGCTCACATC -3'

Sequencing Primer
(F):5'- AGATCATAAATCATCTTGGGGGC -3'
(R):5'- GAACTTGCTCACATCTTTGTATTCAG -3'
Posted On 2022-09-12