Incidental Mutation 'R0764:Zfp113'
ID72548
Institutional Source Beutler Lab
Gene Symbol Zfp113
Ensembl Gene ENSMUSG00000037007
Gene Namezinc finger protein 113
Synonyms
MMRRC Submission 038944-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R0764 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location138139702-138155744 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 138145244 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 248 (Q248L)
Ref Sequence ENSEMBL: ENSMUSP00000127561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049393] [ENSMUST00000165640]
Predicted Effect probably damaging
Transcript: ENSMUST00000049393
AA Change: Q248L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041796
Gene: ENSMUSG00000037007
AA Change: Q248L

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 37 47 N/A INTRINSIC
KRAB 52 113 9.55e-21 SMART
ZnF_C2H2 201 223 8.47e-4 SMART
ZnF_C2H2 229 251 1.6e-4 SMART
ZnF_C2H2 257 279 1.28e-3 SMART
ZnF_C2H2 285 307 2.12e-4 SMART
ZnF_C2H2 313 335 5.59e-4 SMART
ZnF_C2H2 341 363 5.59e-4 SMART
ZnF_C2H2 369 391 1.26e-2 SMART
ZnF_C2H2 397 419 1.06e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165640
AA Change: Q248L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127561
Gene: ENSMUSG00000037007
AA Change: Q248L

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 37 47 N/A INTRINSIC
KRAB 52 113 9.55e-21 SMART
ZnF_C2H2 201 223 8.47e-4 SMART
ZnF_C2H2 229 251 1.6e-4 SMART
ZnF_C2H2 257 279 1.28e-3 SMART
ZnF_C2H2 285 307 2.12e-4 SMART
ZnF_C2H2 313 335 5.59e-4 SMART
ZnF_C2H2 341 363 5.59e-4 SMART
ZnF_C2H2 369 391 1.26e-2 SMART
ZnF_C2H2 397 419 1.06e-4 SMART
Meta Mutation Damage Score 0.4646 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.1%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,059,946 Y898N probably damaging Het
Acp4 T C 7: 44,252,314 probably benign Het
Adipor2 T C 6: 119,357,254 I332V probably benign Het
Ago3 T A 4: 126,355,092 K555N possibly damaging Het
Angpt4 A G 2: 151,911,284 probably benign Het
Ano5 G T 7: 51,537,842 probably benign Het
Ap3b1 C T 13: 94,479,879 probably benign Het
BC025446 T A 15: 75,220,723 F97Y probably benign Het
Cbl A T 9: 44,164,152 C399S probably damaging Het
Cdkl2 C A 5: 92,020,277 V353L probably benign Het
Celsr3 A G 9: 108,827,818 Y500C probably damaging Het
Cep162 A G 9: 87,201,745 S1242P probably damaging Het
Crhr1 C T 11: 104,159,326 R66W probably damaging Het
Ddx49 T C 8: 70,297,257 E170G probably benign Het
Fam193a T C 5: 34,443,341 F305L probably damaging Het
Fam76a C T 4: 132,910,699 G198R probably damaging Het
Gm43302 T A 5: 105,280,489 I130F probably benign Het
Hectd4 T A 5: 121,286,769 I745N possibly damaging Het
Ina T A 19: 47,023,648 *502K probably null Het
Kdm1b A T 13: 47,068,603 D506V possibly damaging Het
Lrrk2 A G 15: 91,775,046 probably null Het
Naip5 A T 13: 100,217,105 D1215E probably benign Het
Neb A G 2: 52,216,867 probably benign Het
Nectin2 T A 7: 19,749,171 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1243 A G 2: 89,527,996 V138A probably benign Het
Olfr170 G T 16: 19,606,432 P79T probably damaging Het
Osbp A G 19: 11,984,156 probably benign Het
Otog A G 7: 46,300,494 D2460G probably benign Het
Pcgf1 T C 6: 83,079,169 C2R probably damaging Het
Per2 C T 1: 91,429,420 V674M probably damaging Het
Pias3 C T 3: 96,701,295 P218S probably damaging Het
Plod3 C T 5: 136,989,583 probably benign Het
Purb C T 11: 6,475,661 V76M probably damaging Het
Ranbp1 C A 16: 18,240,158 E181* probably null Het
Rit2 T C 18: 31,153,701 probably benign Het
Rnf103 C A 6: 71,509,582 T399K probably damaging Het
Slc22a13 T C 9: 119,208,680 probably null Het
Slc35f4 T A 14: 49,306,339 probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tnfrsf17 C T 16: 11,315,199 T47M possibly damaging Het
Tram1 A G 1: 13,579,709 I97T probably damaging Het
Ttc38 T C 15: 85,846,403 probably benign Het
Other mutations in Zfp113
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03033:Zfp113 APN 5 138151196 splice site probably benign
R0217:Zfp113 UTSW 5 138150691 missense probably benign 0.01
R0733:Zfp113 UTSW 5 138145583 missense probably benign 0.18
R0898:Zfp113 UTSW 5 138144789 missense probably benign 0.01
R1591:Zfp113 UTSW 5 138151197 splice site probably benign
R1623:Zfp113 UTSW 5 138145668 missense probably benign 0.00
R2907:Zfp113 UTSW 5 138144957 missense probably benign 0.13
R4840:Zfp113 UTSW 5 138145425 missense probably damaging 1.00
R4950:Zfp113 UTSW 5 138145472 missense probably benign
R5216:Zfp113 UTSW 5 138150715 missense probably damaging 1.00
R6084:Zfp113 UTSW 5 138145668 missense probably benign 0.00
R6766:Zfp113 UTSW 5 138145346 nonsense probably null
R8190:Zfp113 UTSW 5 138144996 missense probably damaging 1.00
R8247:Zfp113 UTSW 5 138145034 missense possibly damaging 0.95
R8266:Zfp113 UTSW 5 138150619 missense probably damaging 1.00
X0020:Zfp113 UTSW 5 138144836 missense probably damaging 1.00
X0022:Zfp113 UTSW 5 138145619 missense possibly damaging 0.71
X0027:Zfp113 UTSW 5 138145713 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTGTGGACGCAGGACATGAAGAA -3'
(R):5'- GGAAAAGCTCACCCATATTGGAGAAAGA -3'

Sequencing Primer
(F):5'- acttccctccacattccatac -3'
(R):5'- TTCCAAACTTATTTCAcatcaaagac -3'
Posted On2013-09-30