Mutagenetix > Incidental Mutation

Incidental Mutation 'R9631:Igsf10'

725484

Institutional Source

Beutler Lab

Gene Symbol

Igsf10

Ensembl Gene

ENSMUSG00000036334

Gene Name

immunoglobulin superfamily, member 10

Synonyms

Adlican2, CMF608, 6530405F15Rik

MMRRC Submission

Accession Numbers

Genbank: NM_001162884; MGI: 1923481

Essential gene?

Probably non essential (E-score: 0.193) question?

Stock #

R9631 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

59316735-59344394 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 59330483 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 759 (L759H)

Ref Sequence

ENSEMBL: ENSMUSP00000037246 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039419] [ENSMUST00000193455] [ENSMUST00000194546]

AlphaFold

Q3V1M1

Predicted Effect

probably damaging
Transcript: ENSMUST00000039419
AA Change: L759H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000037246
Gene: ENSMUSG00000036334
AA Change: L759H

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRRNT	28	61	3.24e-4	SMART
LRR	57	79	9.24e1	SMART
LRR	80	103	2.02e-1	SMART
LRR	104	127	7.16e0	SMART
LRR_TYP	128	151	1.2e-3	SMART
LRR	152	175	1.25e-1	SMART
LRR	188	207	2.33e2	SMART
LRRCT	219	280	4.19e-4	SMART
IGc2	488	558	2.34e-4	SMART
IGc2	586	652	7.88e-11	SMART
low complexity region	917	930	N/A	INTRINSIC
low complexity region	1175	1185	N/A	INTRINSIC
low complexity region	1245	1263	N/A	INTRINSIC
low complexity region	1311	1321	N/A	INTRINSIC
low complexity region	1449	1465	N/A	INTRINSIC
IGc2	1632	1701	7.69e-14	SMART
IGc2	1729	1798	5.07e-14	SMART
IGc2	1826	1895	2.19e-9	SMART
IGc2	1925	1994	4.59e-12	SMART
IGc2	2022	2097	1.33e-8	SMART
IGc2	2125	2191	2.96e-15	SMART
IGc2	2223	2291	2.03e-4	SMART
IGc2	2321	2389	9.99e-13	SMART
IGc2	2416	2484	3.03e-12	SMART
IGc2	2512	2583	7.76e-10	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000193455
AA Change: L759H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141971
Gene: ENSMUSG00000036334
AA Change: L759H

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRRNT	28	61	3.24e-4	SMART
LRR	57	79	9.24e1	SMART
LRR	80	103	2.02e-1	SMART
LRR	104	127	7.16e0	SMART
LRR_TYP	128	151	1.2e-3	SMART
LRR	152	175	1.25e-1	SMART
LRR	188	207	2.33e2	SMART
LRRCT	219	280	4.19e-4	SMART
IGc2	488	558	2.34e-4	SMART
IGc2	586	652	7.88e-11	SMART
low complexity region	917	930	N/A	INTRINSIC
low complexity region	1175	1185	N/A	INTRINSIC
low complexity region	1245	1263	N/A	INTRINSIC
low complexity region	1311	1321	N/A	INTRINSIC
low complexity region	1449	1465	N/A	INTRINSIC
IGc2	1632	1701	7.69e-14	SMART
IGc2	1729	1798	5.07e-14	SMART
IGc2	1826	1895	2.19e-9	SMART
IGc2	1925	1994	4.59e-12	SMART
IGc2	2022	2097	1.33e-8	SMART
IGc2	2125	2191	2.96e-15	SMART
IGc2	2223	2291	2.03e-4	SMART
IGc2	2321	2389	9.99e-13	SMART
IGc2	2416	2484	3.03e-12	SMART
IGc2	2512	2583	7.76e-10	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000194546
AA Change: L759H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141391
Gene: ENSMUSG00000036334
AA Change: L759H

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRRNT	28	61	3.24e-4	SMART
LRR	57	79	9.24e1	SMART
LRR	80	103	2.02e-1	SMART
LRR	104	127	7.16e0	SMART
LRR_TYP	128	151	1.2e-3	SMART
LRR	152	175	1.25e-1	SMART
LRR	188	207	2.33e2	SMART
LRRCT	219	280	4.19e-4	SMART
IGc2	488	558	2.34e-4	SMART
IGc2	586	652	7.88e-11	SMART
low complexity region	917	930	N/A	INTRINSIC
low complexity region	1175	1185	N/A	INTRINSIC
low complexity region	1245	1263	N/A	INTRINSIC
low complexity region	1311	1321	N/A	INTRINSIC
low complexity region	1449	1465	N/A	INTRINSIC
IGc2	1632	1701	7.69e-14	SMART
IGc2	1729	1798	5.07e-14	SMART
IGc2	1826	1895	2.19e-9	SMART
IGc2	1925	1994	4.59e-12	SMART
IGc2	2022	2097	1.33e-8	SMART
IGc2	2125	2191	2.96e-15	SMART
IGc2	2223	2291	2.03e-4	SMART
IGc2	2321	2389	9.99e-13	SMART
IGc2	2416	2484	3.03e-12	SMART
IGc2	2512	2583	7.76e-10	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C02Rik	A	G	5: 30,482,185	D152G		Het
Atl3	A	G	19: 7,532,188	N427S	probably benign	Het
Bcar3	T	A	3: 122,508,152	D165E	possibly damaging	Het
Brap	T	C	5: 121,684,372	I437T	probably benign	Het
Bspry	T	C	4: 62,482,718		probably null	Het
Camkv	G	T	9: 107,945,791	V77L	probably benign	Het
Capn15	A	T	17: 25,963,435	D566E	probably damaging	Het
Ccar2	A	G	14: 70,151,895	V76A	probably damaging	Het
Ccdc142	T	C	6: 83,107,161	C516R	probably benign	Het
Ccdc92b	T	A	11: 74,630,019	V49E		Het
Ccr7	A	G	11: 99,145,790	V102A	probably benign	Het
Cdh23	A	T	10: 60,407,389	V1069E	possibly damaging	Het
Clpb	T	G	7: 101,785,398	V467G	possibly damaging	Het
Crebzf	T	A	7: 90,443,805	L264Q	probably damaging	Het
Ctif	A	G	18: 75,471,954	F505L	probably benign	Het
Cyp2j5	A	G	4: 96,641,285	I283T	probably benign	Het
Ddx39	C	A	8: 83,721,100	H191Q	possibly damaging	Het
Dnajc9	A	T	14: 20,388,602		probably null	Het
Dock7	A	G	4: 98,966,323	L1568P	unknown	Het
Dpp10	T	C	1: 123,341,703	Y659C	probably damaging	Het
Eef1akmt3	A	G	10: 127,041,292	F35L	probably benign	Het
Etl4	A	T	2: 20,661,938	N52I	probably benign	Het
F5	T	A	1: 164,186,854	C565S	probably damaging	Het
Fam170b	T	C	14: 32,835,684	S159P	probably damaging	Het
Fitm2	A	G	2: 163,469,837	I152T	probably damaging	Het
Fn1	T	C	1: 71,586,228	D2473G	probably benign	Het
Fzd2	C	A	11: 102,606,090	D453E	probably benign	Het
Grm5	T	C	7: 87,975,352	Y376H	probably damaging	Het
H2-Q6	T	A	17: 35,425,316	H91Q	probably benign	Het
Hspa4	A	T	11: 53,269,755	V498E	possibly damaging	Het
Jph1	T	C	1: 17,091,383	T352A	probably damaging	Het
Kit	C	T	5: 75,607,029	T24M	possibly damaging	Het
Krtap28-13	T	G	1: 83,061,176	C61G	unknown	Het
Lgr5	T	A	10: 115,466,608	I293F	probably damaging	Het
Lyzl4	GGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAAGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAGGACACACTGCAGAGG	GGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAGGACACACTGCAGAGG	9: 121,583,989		probably null	Het
Mccc1	C	A	3: 35,960,036	E711*	probably null	Het
Mroh2b	C	T	15: 4,917,074	T452I	probably damaging	Het
Ms4a10	G	A	19: 10,967,087	T111I	probably damaging	Het
Myh11	A	T	16: 14,207,577	V1443E		Het
Oc90	A	G	15: 65,897,780	L76P	probably damaging	Het
Olfr1223	T	C	2: 89,145,178		probably benign	Het
Olfr1308	A	G	2: 111,961,032	F14L	probably benign	Het
Olfr1447	A	G	19: 12,901,138	V214A	possibly damaging	Het
Olfr250	G	A	9: 38,368,418	V281M	possibly damaging	Het
Olfr682-ps1	A	T	7: 105,126,400	I290N	probably damaging	Het
Olfr958	G	A	9: 39,550,212	R220*	probably null	Het
Olfr965	A	T	9: 39,719,865	T213S	possibly damaging	Het
Olfr983	A	G	9: 40,092,927	V13A	probably damaging	Het
Pgr	C	A	9: 8,900,846	Q127K	probably benign	Het
Qrich2	GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG	GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG	11: 116,457,541		probably benign	Het
Rfc1	C	T	5: 65,272,508	V852M	probably damaging	Het
Rin2	T	A	2: 145,876,517	L639H	probably damaging	Het
Rpap2	T	A	5: 107,620,426	W377R	probably damaging	Het
Senp7	T	C	16: 56,155,268	S446P	probably benign	Het
Sipa1l1	A	G	12: 82,341,002	M1V	probably null	Het
Slc25a36	A	C	9: 97,100,100	S61A	probably benign	Het
Sptbn2	C	T	19: 4,738,190	R1066W	probably damaging	Het
Tgm6	A	G	2: 130,135,890	S50G	probably benign	Het
Thada	T	C	17: 84,231,156	S1475G	probably benign	Het
Tln1	G	A	4: 43,545,694	A928V	probably damaging	Het
Trip11	G	A	12: 101,893,548	L357F	probably benign	Het
Ttc3	G	T	16: 94,370,722		probably benign	Het
Ttc38	T	C	15: 85,844,458	S204P	possibly damaging	Het
Vmn1r237	A	T	17: 21,314,398	I128F	probably benign	Het
Vmn2r50	A	T	7: 10,053,063	L39*	probably null	Het
Vps4b	A	G	1: 106,780,105	V216A	possibly damaging	Het
Zfp217	T	C	2: 170,114,870	N736S	possibly damaging	Het
Zfp985	A	G	4: 147,581,285	E25G	probably damaging	Het
Zfr	C	T	15: 12,154,542	R604*	probably null	Het
Zscan18	A	G	7: 12,771,730	S577P	possibly damaging	Het

Other mutations in Igsf10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00773:Igsf10	APN	3	59331539	missense	probably benign	0.03
IGL00790:Igsf10	APN	3	59319517	missense	probably damaging	1.00
IGL00916:Igsf10	APN	3	59331127	missense	probably damaging	0.97
IGL00928:Igsf10	APN	3	59330597	missense	probably benign	0.00
IGL01066:Igsf10	APN	3	59327782	critical splice donor site	probably null
IGL01107:Igsf10	APN	3	59331524	missense	probably damaging	1.00
IGL01420:Igsf10	APN	3	59319650	missense	probably benign	0.02
IGL01533:Igsf10	APN	3	59319230	missense	probably damaging	0.98
IGL01537:Igsf10	APN	3	59330031	missense	probably benign	0.00
IGL01676:Igsf10	APN	3	59326011	missense	probably benign	0.06
IGL01676:Igsf10	APN	3	59329335	missense	probably benign	0.17
IGL01960:Igsf10	APN	3	59318737	missense	probably benign	0.00
IGL02123:Igsf10	APN	3	59318660	missense	probably damaging	0.97
IGL02198:Igsf10	APN	3	59325978	missense	possibly damaging	0.95
IGL02268:Igsf10	APN	3	59331152	nonsense	probably null
IGL02313:Igsf10	APN	3	59330690	missense	probably benign	0.01
IGL02368:Igsf10	APN	3	59328231	missense	probably benign
IGL02494:Igsf10	APN	3	59328006	missense	probably damaging	0.98
IGL02549:Igsf10	APN	3	59329241	missense	probably benign	0.03
IGL02616:Igsf10	APN	3	59318606	missense	probably benign	0.06
IGL02957:Igsf10	APN	3	59330864	missense	probably damaging	1.00
IGL03067:Igsf10	APN	3	59318918	missense	probably benign	0.25
IGL03104:Igsf10	APN	3	59319484	missense	probably damaging	1.00
IGL03124:Igsf10	APN	3	59319665	missense	probably benign	0.01
IGL03212:Igsf10	APN	3	59328165	missense	probably benign	0.09
IGL03347:Igsf10	APN	3	59331900	missense	possibly damaging	0.94
IGL03357:Igsf10	APN	3	59336211	missense	probably benign	0.35
F6893:Igsf10	UTSW	3	59331060	missense	probably damaging	1.00
FR4449:Igsf10	UTSW	3	59319110	missense	probably damaging	1.00
PIT1430001:Igsf10	UTSW	3	59328158	missense	probably benign	0.06
PIT4402001:Igsf10	UTSW	3	59325579	missense	probably benign	0.00
PIT4810001:Igsf10	UTSW	3	59318482	missense	probably damaging	1.00
R0068:Igsf10	UTSW	3	59330624	missense	probably damaging	0.98
R0095:Igsf10	UTSW	3	59331196	nonsense	probably null
R0095:Igsf10	UTSW	3	59331196	nonsense	probably null
R0112:Igsf10	UTSW	3	59326008	missense	probably benign	0.00
R0141:Igsf10	UTSW	3	59330832	missense	probably damaging	1.00
R0538:Igsf10	UTSW	3	59320106	missense	probably damaging	0.99
R0551:Igsf10	UTSW	3	59328668	missense	probably benign	0.01
R0556:Igsf10	UTSW	3	59328875	missense	probably benign	0.02
R0582:Igsf10	UTSW	3	59319767	missense	probably benign	0.00
R0630:Igsf10	UTSW	3	59326062	missense	probably damaging	1.00
R0675:Igsf10	UTSW	3	59328594	missense	probably benign	0.14
R0948:Igsf10	UTSW	3	59331104	missense	probably damaging	1.00
R1252:Igsf10	UTSW	3	59331848	missense	probably benign	0.03
R1412:Igsf10	UTSW	3	59327775	splice site	probably benign
R1473:Igsf10	UTSW	3	59318767	missense	probably damaging	1.00
R1585:Igsf10	UTSW	3	59330417	missense	probably damaging	1.00
R1650:Igsf10	UTSW	3	59326162	missense	probably damaging	1.00
R1660:Igsf10	UTSW	3	59331285	missense	probably damaging	1.00
R1671:Igsf10	UTSW	3	59328500	nonsense	probably null
R1748:Igsf10	UTSW	3	59319093	missense	probably damaging	1.00
R1758:Igsf10	UTSW	3	59329196	missense	probably benign	0.09
R1856:Igsf10	UTSW	3	59331272	missense	possibly damaging	0.63
R1912:Igsf10	UTSW	3	59329572	missense	probably benign	0.40
R2148:Igsf10	UTSW	3	59336577	missense	possibly damaging	0.77
R2155:Igsf10	UTSW	3	59331680	missense	probably damaging	1.00
R2509:Igsf10	UTSW	3	59331866	missense	probably damaging	1.00
R2511:Igsf10	UTSW	3	59331866	missense	probably damaging	1.00
R2680:Igsf10	UTSW	3	59325454	missense	probably benign	0.14
R2913:Igsf10	UTSW	3	59331736	missense	possibly damaging	0.70
R2927:Igsf10	UTSW	3	59329427	missense	probably benign
R3547:Igsf10	UTSW	3	59330541	missense	probably benign	0.02
R3547:Igsf10	UTSW	3	59336514	missense	probably damaging	1.00
R3548:Igsf10	UTSW	3	59336514	missense	probably damaging	1.00
R3620:Igsf10	UTSW	3	59336331	missense	probably damaging	1.00
R3732:Igsf10	UTSW	3	59325714	missense	probably benign	0.29
R3743:Igsf10	UTSW	3	59326125	missense	possibly damaging	0.69
R3973:Igsf10	UTSW	3	59331924	missense	probably damaging	1.00
R4005:Igsf10	UTSW	3	59328560	missense	probably benign	0.00
R4184:Igsf10	UTSW	3	59319731	missense	probably damaging	1.00
R4302:Igsf10	UTSW	3	59318750	missense	probably damaging	1.00
R4404:Igsf10	UTSW	3	59329551	missense	probably benign	0.04
R4575:Igsf10	UTSW	3	59330100	missense	probably benign
R4676:Igsf10	UTSW	3	59325949	missense	probably benign	0.23
R4700:Igsf10	UTSW	3	59320330	missense	probably damaging	0.99
R4765:Igsf10	UTSW	3	59329705	missense	probably benign	0.01
R4986:Igsf10	UTSW	3	59328606	missense	probably benign	0.24
R5012:Igsf10	UTSW	3	59318722	missense	probably damaging	1.00
R5070:Igsf10	UTSW	3	59328293	missense	probably benign	0.02
R5083:Igsf10	UTSW	3	59326273	missense	probably damaging	1.00
R5336:Igsf10	UTSW	3	59320132	missense	probably damaging	1.00
R5462:Igsf10	UTSW	3	59325754	missense	probably damaging	1.00
R5648:Igsf10	UTSW	3	59328153	missense	probably benign	0.01
R5810:Igsf10	UTSW	3	59319071	missense	probably damaging	1.00
R5871:Igsf10	UTSW	3	59330411	missense	possibly damaging	0.83
R5880:Igsf10	UTSW	3	59330831	missense	probably damaging	1.00
R5935:Igsf10	UTSW	3	59328157	missense	probably benign	0.12
R5979:Igsf10	UTSW	3	59336473	missense	probably damaging	1.00
R6145:Igsf10	UTSW	3	59331656	missense	possibly damaging	0.83
R6222:Igsf10	UTSW	3	59318915	missense	possibly damaging	0.90
R6224:Igsf10	UTSW	3	59325510	missense	probably damaging	1.00
R6264:Igsf10	UTSW	3	59328507	missense	possibly damaging	0.88
R6283:Igsf10	UTSW	3	59319449	missense	probably damaging	1.00
R6336:Igsf10	UTSW	3	59330339	missense	probably benign	0.00
R6490:Igsf10	UTSW	3	59329571	missense	probably benign	0.06
R6785:Igsf10	UTSW	3	59319244	missense	probably damaging	1.00
R6873:Igsf10	UTSW	3	59328444	missense	probably benign
R6889:Igsf10	UTSW	3	59331933	missense	probably benign
R7024:Igsf10	UTSW	3	59331701	missense	probably benign	0.00
R7056:Igsf10	UTSW	3	59331080	missense	probably damaging	1.00
R7128:Igsf10	UTSW	3	59328905	missense	probably benign
R7251:Igsf10	UTSW	3	59319454	missense	probably damaging	1.00
R7313:Igsf10	UTSW	3	59329416	missense	probably benign	0.05
R7340:Igsf10	UTSW	3	59325768	missense	probably damaging	1.00
R7447:Igsf10	UTSW	3	59331801	missense	probably benign	0.39
R7506:Igsf10	UTSW	3	59319354	missense	probably damaging	1.00
R7678:Igsf10	UTSW	3	59319340	missense	possibly damaging	0.81
R7695:Igsf10	UTSW	3	59326191	missense	probably damaging	1.00
R7709:Igsf10	UTSW	3	59331543	missense	probably damaging	0.96
R7749:Igsf10	UTSW	3	59329128	missense	possibly damaging	0.88
R7808:Igsf10	UTSW	3	59328068	missense	probably benign	0.00
R7850:Igsf10	UTSW	3	59319632	missense	probably benign	0.33
R7879:Igsf10	UTSW	3	59330724	missense	probably damaging	1.00
R7886:Igsf10	UTSW	3	59328327	missense	probably benign	0.01
R7891:Igsf10	UTSW	3	59328411	nonsense	probably null
R7946:Igsf10	UTSW	3	59319704	missense	possibly damaging	0.69
R7948:Igsf10	UTSW	3	59331858	missense	probably benign	0.02
R8004:Igsf10	UTSW	3	59329709	missense	probably benign	0.01
R8096:Igsf10	UTSW	3	59328959	missense	probably damaging	0.98
R8141:Igsf10	UTSW	3	59330528	missense	probably damaging	0.96
R8183:Igsf10	UTSW	3	59330615	missense	probably benign	0.04
R8203:Igsf10	UTSW	3	59328833	missense	probably benign	0.11
R8325:Igsf10	UTSW	3	59318533	missense	probably damaging	0.96
R8350:Igsf10	UTSW	3	59331528	missense	probably damaging	1.00
R8387:Igsf10	UTSW	3	59329143	missense	probably damaging	1.00
R8488:Igsf10	UTSW	3	59320010	missense	probably damaging	1.00
R8697:Igsf10	UTSW	3	59318887	missense	probably benign	0.02
R8786:Igsf10	UTSW	3	59330642	missense	probably benign	0.25
R8804:Igsf10	UTSW	3	59336455	missense	probably damaging	1.00
R8886:Igsf10	UTSW	3	59329989	missense	probably benign	0.00
R8902:Igsf10	UTSW	3	59336212	missense	probably benign	0.00
R8906:Igsf10	UTSW	3	59326318	missense	probably benign	0.01
R8917:Igsf10	UTSW	3	59319467	missense	possibly damaging	0.69
R9051:Igsf10	UTSW	3	59329247	missense	probably benign	0.00
R9178:Igsf10	UTSW	3	59326059	missense	possibly damaging	0.69
R9228:Igsf10	UTSW	3	59336422	missense	probably damaging	1.00
R9230:Igsf10	UTSW	3	59336422	missense	probably damaging	1.00
R9231:Igsf10	UTSW	3	59336422	missense	probably damaging	1.00
R9232:Igsf10	UTSW	3	59336422	missense	probably damaging	1.00
R9417:Igsf10	UTSW	3	59329105	missense	possibly damaging	0.94
R9609:Igsf10	UTSW	3	59319448	missense	probably damaging	1.00
R9689:Igsf10	UTSW	3	59326203	missense	probably damaging	1.00
R9762:Igsf10	UTSW	3	59329685	missense	probably damaging	1.00
R9770:Igsf10	UTSW	3	59319778	missense	probably benign	0.07
R9798:Igsf10	UTSW	3	59331705	missense	probably damaging	1.00
Z1088:Igsf10	UTSW	3	59329938	missense	possibly damaging	0.59
Z1177:Igsf10	UTSW	3	59329605	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTGGTGACCTTTCTGGGACAC -3'
(R):5'- GTTCTCCTTAAGCAGCCACC -3'

Sequencing Primer
(F):5'- GGGACACCAAAAGCCTTAGTTTTCAG -3'
(R):5'- CCTGCATCATCTTTGACAGGGAC -3'

Posted On

2022-09-12