Mutagenetix > Incidental Mutation

Incidental Mutation 'R0764:Rnf103'

72549

Institutional Source

Beutler Lab

Gene Symbol

Rnf103

Ensembl Gene

ENSMUSG00000052656

Gene Name

ring finger protein 103

Synonyms

Zfp103, kf-1

MMRRC Submission

038944-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.213) question?

Stock #

R0764 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

71493894-71510881 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 71509582 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 399 (T399K)

Ref Sequence

ENSEMBL: ENSMUSP00000109817 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064637] [ENSMUST00000114178] [ENSMUST00000114179]

AlphaFold

Q9R1W3

Predicted Effect

probably damaging
Transcript: ENSMUST00000064637
AA Change: T399K

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000066324
Gene: ENSMUSG00000052656
AA Change: T399K

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
transmembrane domain	326	348	N/A	INTRINSIC
transmembrane domain	353	375	N/A	INTRINSIC
transmembrane domain	412	431	N/A	INTRINSIC
low complexity region	523	531	N/A	INTRINSIC
RING	619	660	5.07e-6	SMART
low complexity region	665	676	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114178

SMART Domains

Protein: ENSMUSP00000109816
Gene: ENSMUSG00000052656

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
low complexity region	162	173	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000114179
AA Change: T399K

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000109817
Gene: ENSMUSG00000052656
AA Change: T399K

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
transmembrane domain	326	348	N/A	INTRINSIC
transmembrane domain	353	375	N/A	INTRINSIC
transmembrane domain	412	431	N/A	INTRINSIC
low complexity region	523	531	N/A	INTRINSIC
RING	619	660	5.07e-6	SMART
low complexity region	665	676	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150069

Meta Mutation Damage Score

0.2562

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.1%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: This gene encodes a member of the RING finger family of E3 ubiquitin-protein ligases. These proteins catalyze the transfer of the ubiquitin protein from a ubiquitin E2 enzyme to a protein substrate. Homozygous knockout mice for this gene exhibit enhanced anxiety-like behavior. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display significantly increased anxiety-like behavior under stressful conditions as well as increased prepulse inhibition and a reduced startle amplitude with no detectable changes in exploratory locomotion or behavioral despair. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	A	T	11: 110,059,946	Y898N	probably damaging	Het
Acp4	T	C	7: 44,252,314		probably benign	Het
Adipor2	T	C	6: 119,357,254	I332V	probably benign	Het
Ago3	T	A	4: 126,355,092	K555N	possibly damaging	Het
Angpt4	A	G	2: 151,911,284		probably benign	Het
Ano5	G	T	7: 51,537,842		probably benign	Het
Ap3b1	C	T	13: 94,479,879		probably benign	Het
BC025446	T	A	15: 75,220,723	F97Y	probably benign	Het
Cbl	A	T	9: 44,164,152	C399S	probably damaging	Het
Cdkl2	C	A	5: 92,020,277	V353L	probably benign	Het
Celsr3	A	G	9: 108,827,818	Y500C	probably damaging	Het
Cep162	A	G	9: 87,201,745	S1242P	probably damaging	Het
Crhr1	C	T	11: 104,159,326	R66W	probably damaging	Het
Ddx49	T	C	8: 70,297,257	E170G	probably benign	Het
Fam193a	T	C	5: 34,443,341	F305L	probably damaging	Het
Fam76a	C	T	4: 132,910,699	G198R	probably damaging	Het
Gm43302	T	A	5: 105,280,489	I130F	probably benign	Het
Hectd4	T	A	5: 121,286,769	I745N	possibly damaging	Het
Ina	T	A	19: 47,023,648	*502K	probably null	Het
Kdm1b	A	T	13: 47,068,603	D506V	possibly damaging	Het
Lrrk2	A	G	15: 91,775,046		probably null	Het
Naip5	A	T	13: 100,217,105	D1215E	probably benign	Het
Neb	A	G	2: 52,216,867		probably benign	Het
Nectin2	T	A	7: 19,749,171		probably null	Het
Nup155	A	T	15: 8,157,760	H1391L	probably damaging	Het
Olfr1243	A	G	2: 89,527,996	V138A	probably benign	Het
Olfr170	G	T	16: 19,606,432	P79T	probably damaging	Het
Osbp	A	G	19: 11,984,156		probably benign	Het
Otog	A	G	7: 46,300,494	D2460G	probably benign	Het
Pcgf1	T	C	6: 83,079,169	C2R	probably damaging	Het
Per2	C	T	1: 91,429,420	V674M	probably damaging	Het
Pias3	C	T	3: 96,701,295	P218S	probably damaging	Het
Plod3	C	T	5: 136,989,583		probably benign	Het
Purb	C	T	11: 6,475,661	V76M	probably damaging	Het
Ranbp1	C	A	16: 18,240,158	E181*	probably null	Het
Rit2	T	C	18: 31,153,701		probably benign	Het
Slc22a13	T	C	9: 119,208,680		probably null	Het
Slc35f4	T	A	14: 49,306,339		probably benign	Het
Sucla2	C	T	14: 73,560,634		probably benign	Het
Tnfrsf17	C	T	16: 11,315,199	T47M	possibly damaging	Het
Tram1	A	G	1: 13,579,709	I97T	probably damaging	Het
Ttc38	T	C	15: 85,846,403		probably benign	Het
Zfp113	T	A	5: 138,145,244	Q248L	probably damaging	Het

Other mutations in Rnf103

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00510:Rnf103	APN	6	71509749	missense	probably damaging	0.99
IGL00589:Rnf103	APN	6	71509083	missense	probably benign	0.00
IGL01601:Rnf103	APN	6	71509183	missense	probably damaging	1.00
IGL01732:Rnf103	APN	6	71510382	missense	probably damaging	0.97
IGL02130:Rnf103	APN	6	71509564	missense	probably damaging	1.00
IGL02227:Rnf103	APN	6	71510188	missense	probably benign	0.01
IGL02386:Rnf103	APN	6	71509218	missense	probably benign
IGL02532:Rnf103	APN	6	71509825	missense	probably benign	0.19
IGL02532:Rnf103	APN	6	71509652	missense	probably damaging	0.96
IGL02747:Rnf103	APN	6	71509177	missense	probably damaging	0.97
IGL02839:Rnf103	APN	6	71509705	missense	probably benign	0.41
IGL03247:Rnf103	APN	6	71510305	missense	possibly damaging	0.78
R0140:Rnf103	UTSW	6	71509331	missense	possibly damaging	0.76
R0308:Rnf103	UTSW	6	71509702	missense	probably damaging	1.00
R1428:Rnf103	UTSW	6	71508999	missense	probably damaging	1.00
R2362:Rnf103	UTSW	6	71510017	missense	probably benign	0.08
R3847:Rnf103	UTSW	6	71508875	missense	probably damaging	1.00
R3849:Rnf103	UTSW	6	71508875	missense	probably damaging	1.00
R3919:Rnf103	UTSW	6	71510347	missense	probably benign	0.08
R4914:Rnf103	UTSW	6	71510264	missense	possibly damaging	0.71
R5620:Rnf103	UTSW	6	71510008	missense	probably benign	0.04
R5634:Rnf103	UTSW	6	71509617	missense	probably benign	0.01
R5682:Rnf103	UTSW	6	71508724	intron	probably benign
R5791:Rnf103	UTSW	6	71508925	missense	probably damaging	0.99
R5994:Rnf103	UTSW	6	71496910	missense	probably damaging	0.99
R6347:Rnf103	UTSW	6	71505824	missense	possibly damaging	0.89
R6551:Rnf103	UTSW	6	71510365	missense	probably damaging	1.00
R7739:Rnf103	UTSW	6	71509479	missense	possibly damaging	0.77
R7819:Rnf103	UTSW	6	71508930	missense	probably benign	0.00
R7903:Rnf103	UTSW	6	71509154	missense	probably damaging	1.00
R8750:Rnf103	UTSW	6	71509618	missense	probably benign	0.11
R8784:Rnf103	UTSW	6	71509998	missense	probably benign	0.03
R8974:Rnf103	UTSW	6	71509108	missense	probably damaging	0.98
R9154:Rnf103	UTSW	6	71510115	missense	probably benign	0.06
R9505:Rnf103	UTSW	6	71510065	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGAGCAACCATCAAGCGATTTGTG -3'
(R):5'- TCAGGGTCTTCGTCCCAATCAGAG -3'

Sequencing Primer
(F):5'- CGATTTGTGGTTCTCATAAGCAC -3'
(R):5'- GTGTACCAGTCCCACAGACTTG -3'

Posted On

2013-09-30