Incidental Mutation 'R0764:Acp4'
ID72553
Institutional Source Beutler Lab
Gene Symbol Acp4
Ensembl Gene ENSMUSG00000012777
Gene Nameacid phosphatase 4
SynonymsEG546967, Acpt
MMRRC Submission 038944-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R0764 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44252148-44257378 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 44252314 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012921] [ENSMUST00000055858] [ENSMUST00000071296] [ENSMUST00000071296] [ENSMUST00000071296] [ENSMUST00000071296] [ENSMUST00000084937] [ENSMUST00000107945] [ENSMUST00000107948] [ENSMUST00000107949] [ENSMUST00000107949] [ENSMUST00000107949] [ENSMUST00000107949] [ENSMUST00000107950] [ENSMUST00000107950] [ENSMUST00000107950] [ENSMUST00000107950] [ENSMUST00000118216] [ENSMUST00000137702] [ENSMUST00000145653] [ENSMUST00000146155] [ENSMUST00000185481] [ENSMUST00000186606] [ENSMUST00000187524] [ENSMUST00000188111] [ENSMUST00000188382] [ENSMUST00000191537]
Predicted Effect probably benign
Transcript: ENSMUST00000012921
SMART Domains Protein: ENSMUSP00000012921
Gene: ENSMUSG00000012777

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:His_Phos_2 30 338 3.2e-53 PFAM
transmembrane domain 391 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055858
SMART Domains Protein: ENSMUSP00000103583
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071296
SMART Domains Protein: ENSMUSP00000071265
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071296
SMART Domains Protein: ENSMUSP00000071265
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071296
SMART Domains Protein: ENSMUSP00000071265
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071296
SMART Domains Protein: ENSMUSP00000071265
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084937
SMART Domains Protein: ENSMUSP00000095894
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000107945
AA Change: R432G
SMART Domains Protein: ENSMUSP00000103578
Gene: ENSMUSG00000012777
AA Change: R432G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:His_Phos_2 30 324 2.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107948
SMART Domains Protein: ENSMUSP00000103581
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107949
SMART Domains Protein: ENSMUSP00000103582
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107949
SMART Domains Protein: ENSMUSP00000103582
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107949
SMART Domains Protein: ENSMUSP00000103582
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107949
SMART Domains Protein: ENSMUSP00000103582
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107950
SMART Domains Protein: ENSMUSP00000103584
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107950
SMART Domains Protein: ENSMUSP00000103584
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107950
SMART Domains Protein: ENSMUSP00000103584
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107950
SMART Domains Protein: ENSMUSP00000103584
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117033
Predicted Effect probably benign
Transcript: ENSMUST00000118216
SMART Domains Protein: ENSMUSP00000112922
Gene: ENSMUSG00000012777

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:His_Phos_2 30 338 3.2e-53 PFAM
transmembrane domain 392 414 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136210
Predicted Effect probably benign
Transcript: ENSMUST00000137702
SMART Domains Protein: ENSMUSP00000119445
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144905
Predicted Effect probably benign
Transcript: ENSMUST00000145653
Predicted Effect probably benign
Transcript: ENSMUST00000146155
SMART Domains Protein: ENSMUSP00000117318
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185481
SMART Domains Protein: ENSMUSP00000139913
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186606
SMART Domains Protein: ENSMUSP00000139441
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 50 60 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187524
SMART Domains Protein: ENSMUSP00000140017
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187581
Predicted Effect probably benign
Transcript: ENSMUST00000188111
SMART Domains Protein: ENSMUSP00000139694
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188382
SMART Domains Protein: ENSMUSP00000140200
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188476
Predicted Effect probably benign
Transcript: ENSMUST00000191537
SMART Domains Protein: ENSMUSP00000141077
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 50 60 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.1%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acid phosphatases are enzymes capable of hydrolyzing orthophosphoric acid esters in an acid medium. This gene is up-regulated by androgens and is down-regulated by estrogens in the prostate cancer cell line. This gene exhibits a lower level of expression in testicular cancer tissues than in normal tissues. The protein encoded by this gene has structural similarity to prostatic and lysosomal acid phosphatases. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,059,946 Y898N probably damaging Het
Adipor2 T C 6: 119,357,254 I332V probably benign Het
Ago3 T A 4: 126,355,092 K555N possibly damaging Het
Angpt4 A G 2: 151,911,284 probably benign Het
Ano5 G T 7: 51,537,842 probably benign Het
Ap3b1 C T 13: 94,479,879 probably benign Het
BC025446 T A 15: 75,220,723 F97Y probably benign Het
Cbl A T 9: 44,164,152 C399S probably damaging Het
Cdkl2 C A 5: 92,020,277 V353L probably benign Het
Celsr3 A G 9: 108,827,818 Y500C probably damaging Het
Cep162 A G 9: 87,201,745 S1242P probably damaging Het
Crhr1 C T 11: 104,159,326 R66W probably damaging Het
Ddx49 T C 8: 70,297,257 E170G probably benign Het
Fam193a T C 5: 34,443,341 F305L probably damaging Het
Fam76a C T 4: 132,910,699 G198R probably damaging Het
Gm43302 T A 5: 105,280,489 I130F probably benign Het
Hectd4 T A 5: 121,286,769 I745N possibly damaging Het
Ina T A 19: 47,023,648 *502K probably null Het
Kdm1b A T 13: 47,068,603 D506V possibly damaging Het
Lrrk2 A G 15: 91,775,046 probably null Het
Naip5 A T 13: 100,217,105 D1215E probably benign Het
Neb A G 2: 52,216,867 probably benign Het
Nectin2 T A 7: 19,749,171 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1243 A G 2: 89,527,996 V138A probably benign Het
Olfr170 G T 16: 19,606,432 P79T probably damaging Het
Osbp A G 19: 11,984,156 probably benign Het
Otog A G 7: 46,300,494 D2460G probably benign Het
Pcgf1 T C 6: 83,079,169 C2R probably damaging Het
Per2 C T 1: 91,429,420 V674M probably damaging Het
Pias3 C T 3: 96,701,295 P218S probably damaging Het
Plod3 C T 5: 136,989,583 probably benign Het
Purb C T 11: 6,475,661 V76M probably damaging Het
Ranbp1 C A 16: 18,240,158 E181* probably null Het
Rit2 T C 18: 31,153,701 probably benign Het
Rnf103 C A 6: 71,509,582 T399K probably damaging Het
Slc22a13 T C 9: 119,208,680 probably null Het
Slc35f4 T A 14: 49,306,339 probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tnfrsf17 C T 16: 11,315,199 T47M possibly damaging Het
Tram1 A G 1: 13,579,709 I97T probably damaging Het
Ttc38 T C 15: 85,846,403 probably benign Het
Zfp113 T A 5: 138,145,244 Q248L probably damaging Het
Other mutations in Acp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Acp4 APN 7 44253451 missense possibly damaging 0.56
IGL01067:Acp4 APN 7 44253452 missense probably benign 0.08
IGL01739:Acp4 APN 7 44256786 nonsense probably null
IGL02013:Acp4 APN 7 44255081 missense probably benign 0.13
IGL02225:Acp4 APN 7 44256741 unclassified probably null
IGL02648:Acp4 APN 7 44254990 unclassified probably benign
R1328:Acp4 UTSW 7 44257092 splice site probably null
R1411:Acp4 UTSW 7 44256843 unclassified probably benign
R1754:Acp4 UTSW 7 44255004 missense probably benign 0.09
R2163:Acp4 UTSW 7 44255976 missense probably damaging 1.00
R2193:Acp4 UTSW 7 44253569 missense probably benign 0.01
R5120:Acp4 UTSW 7 44256971 missense probably damaging 1.00
R7890:Acp4 UTSW 7 44254104 missense probably damaging 1.00
R7973:Acp4 UTSW 7 44254104 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCCAGTCTCCCTAGTGTAAAG -3'
(R):5'- GGAGCATACCCTGGAATCCAAGAAC -3'

Sequencing Primer
(F):5'- CAGTCTCCCTAGTGTAAAGGCTTAAC -3'
(R):5'- ACTAGAGGGTCTGATCAATTGC -3'
Posted On2013-09-30