Incidental Mutation 'R9631:Sptbn2'
ID 725537
Institutional Source Beutler Lab
Gene Symbol Sptbn2
Ensembl Gene ENSMUSG00000067889
Gene Name spectrin beta, non-erythrocytic 2
Synonyms Spnb3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9631 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 4711208-4752353 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 4738190 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 1066 (R1066W)
Ref Sequence ENSEMBL: ENSMUSP00000008991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008991] [ENSMUST00000178353]
AlphaFold Q68FG2
Predicted Effect probably damaging
Transcript: ENSMUST00000008991
AA Change: R1066W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000008991
Gene: ENSMUSG00000067889
AA Change: R1066W

DomainStartEndE-ValueType
CH 59 159 1.86e-28 SMART
CH 178 276 2.86e-20 SMART
SPEC 308 414 4.63e-1 SMART
SPEC 428 528 3.07e-23 SMART
SPEC 534 638 4.47e-25 SMART
SPEC 644 744 1.28e-25 SMART
SPEC 750 849 4.98e-23 SMART
SPEC 855 955 1.63e-18 SMART
SPEC 961 1062 1.45e-24 SMART
SPEC 1068 1169 4.15e-20 SMART
SPEC 1175 1275 5.26e-22 SMART
SPEC 1281 1380 1.17e-19 SMART
SPEC 1386 1485 2.06e-24 SMART
SPEC 1491 1585 1.74e-22 SMART
SPEC 1591 1691 5.42e-24 SMART
SPEC 1697 1798 2.1e-21 SMART
SPEC 1804 1904 5.47e-20 SMART
SPEC 1910 2010 1.99e-22 SMART
SPEC 2016 2256 2.92e-6 SMART
PH 2219 2330 1.65e-14 SMART
low complexity region 2373 2386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178353
SMART Domains Protein: ENSMUSP00000136599
Gene: ENSMUSG00000096370

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
Pfam:RRM_1 81 118 5.6e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous hypomorphic mutants exhibit a progressive ataxic phenotype with gait abnormalities, tremor, deteriorating motor coordination, Purkinje cell loss, and cerebellar atrophy (molecular layer thinning) and age-related reduction in simple firing ratein surviving Purkinje cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A G 5: 30,482,185 D152G Het
Atl3 A G 19: 7,532,188 N427S probably benign Het
Bcar3 T A 3: 122,508,152 D165E possibly damaging Het
Brap T C 5: 121,684,372 I437T probably benign Het
Bspry T C 4: 62,482,718 probably null Het
Camkv G T 9: 107,945,791 V77L probably benign Het
Capn15 A T 17: 25,963,435 D566E probably damaging Het
Ccar2 A G 14: 70,151,895 V76A probably damaging Het
Ccdc142 T C 6: 83,107,161 C516R probably benign Het
Ccdc92b T A 11: 74,630,019 V49E Het
Ccr7 A G 11: 99,145,790 V102A probably benign Het
Cdh23 A T 10: 60,407,389 V1069E possibly damaging Het
Clpb T G 7: 101,785,398 V467G possibly damaging Het
Crebzf T A 7: 90,443,805 L264Q probably damaging Het
Ctif A G 18: 75,471,954 F505L probably benign Het
Cyp2j5 A G 4: 96,641,285 I283T probably benign Het
Ddx39 C A 8: 83,721,100 H191Q possibly damaging Het
Dnajc9 A T 14: 20,388,602 probably null Het
Dock7 A G 4: 98,966,323 L1568P unknown Het
Dpp10 T C 1: 123,341,703 Y659C probably damaging Het
Eef1akmt3 A G 10: 127,041,292 F35L probably benign Het
Etl4 A T 2: 20,661,938 N52I probably benign Het
F5 T A 1: 164,186,854 C565S probably damaging Het
Fam170b T C 14: 32,835,684 S159P probably damaging Het
Fitm2 A G 2: 163,469,837 I152T probably damaging Het
Fn1 T C 1: 71,586,228 D2473G probably benign Het
Fzd2 C A 11: 102,606,090 D453E probably benign Het
Grm5 T C 7: 87,975,352 Y376H probably damaging Het
H2-Q6 T A 17: 35,425,316 H91Q probably benign Het
Hspa4 A T 11: 53,269,755 V498E possibly damaging Het
Igsf10 A T 3: 59,330,483 L759H probably damaging Het
Jph1 T C 1: 17,091,383 T352A probably damaging Het
Kit C T 5: 75,607,029 T24M possibly damaging Het
Krtap28-13 T G 1: 83,061,176 C61G unknown Het
Lgr5 T A 10: 115,466,608 I293F probably damaging Het
Lyzl4 GGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAAGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAGGACACACTGCAGAGG GGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAGGACACACTGCAGAGG 9: 121,583,989 probably null Het
Mccc1 C A 3: 35,960,036 E711* probably null Het
Mroh2b C T 15: 4,917,074 T452I probably damaging Het
Ms4a10 G A 19: 10,967,087 T111I probably damaging Het
Myh11 A T 16: 14,207,577 V1443E Het
Oc90 A G 15: 65,897,780 L76P probably damaging Het
Olfr1223 T C 2: 89,145,178 probably benign Het
Olfr1308 A G 2: 111,961,032 F14L probably benign Het
Olfr1447 A G 19: 12,901,138 V214A possibly damaging Het
Olfr250 G A 9: 38,368,418 V281M possibly damaging Het
Olfr682-ps1 A T 7: 105,126,400 I290N probably damaging Het
Olfr958 G A 9: 39,550,212 R220* probably null Het
Olfr965 A T 9: 39,719,865 T213S possibly damaging Het
Olfr983 A G 9: 40,092,927 V13A probably damaging Het
Pgr C A 9: 8,900,846 Q127K probably benign Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rfc1 C T 5: 65,272,508 V852M probably damaging Het
Rin2 T A 2: 145,876,517 L639H probably damaging Het
Rpap2 T A 5: 107,620,426 W377R probably damaging Het
Senp7 T C 16: 56,155,268 S446P probably benign Het
Sipa1l1 A G 12: 82,341,002 M1V probably null Het
Slc25a36 A C 9: 97,100,100 S61A probably benign Het
Tgm6 A G 2: 130,135,890 S50G probably benign Het
Thada T C 17: 84,231,156 S1475G probably benign Het
Tln1 G A 4: 43,545,694 A928V probably damaging Het
Trip11 G A 12: 101,893,548 L357F probably benign Het
Ttc3 G T 16: 94,370,722 probably benign Het
Ttc38 T C 15: 85,844,458 S204P possibly damaging Het
Vmn1r237 A T 17: 21,314,398 I128F probably benign Het
Vmn2r50 A T 7: 10,053,063 L39* probably null Het
Vps4b A G 1: 106,780,105 V216A possibly damaging Het
Zfp217 T C 2: 170,114,870 N736S possibly damaging Het
Zfp985 A G 4: 147,581,285 E25G probably damaging Het
Zfr C T 15: 12,154,542 R604* probably null Het
Zscan18 A G 7: 12,771,730 S577P possibly damaging Het
Other mutations in Sptbn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Sptbn2 APN 19 4724705 missense possibly damaging 0.94
IGL00688:Sptbn2 APN 19 4725938 missense probably damaging 1.00
IGL01339:Sptbn2 APN 19 4745972 nonsense probably null
IGL01373:Sptbn2 APN 19 4745972 nonsense probably null
IGL01420:Sptbn2 APN 19 4734125 missense probably benign
IGL01456:Sptbn2 APN 19 4746749 missense probably damaging 1.00
IGL01953:Sptbn2 APN 19 4749693 missense probably benign
IGL03026:Sptbn2 APN 19 4724233 critical splice donor site probably null
IGL03275:Sptbn2 APN 19 4732661 missense possibly damaging 0.65
IGL03286:Sptbn2 APN 19 4747832 missense probably damaging 0.97
F5770:Sptbn2 UTSW 19 4750632 missense probably damaging 1.00
PIT4696001:Sptbn2 UTSW 19 4745577 missense probably benign 0.00
R0046:Sptbn2 UTSW 19 4745377 intron probably benign
R0046:Sptbn2 UTSW 19 4745377 intron probably benign
R0121:Sptbn2 UTSW 19 4745293 missense probably damaging 1.00
R0127:Sptbn2 UTSW 19 4724744 missense probably damaging 1.00
R0212:Sptbn2 UTSW 19 4746942 critical splice donor site probably null
R0277:Sptbn2 UTSW 19 4745145 missense probably benign 0.28
R0417:Sptbn2 UTSW 19 4737926 missense probably benign 0.01
R0457:Sptbn2 UTSW 19 4745938 missense possibly damaging 0.89
R0536:Sptbn2 UTSW 19 4726690 missense probably damaging 0.99
R0631:Sptbn2 UTSW 19 4739986 missense probably benign 0.01
R0734:Sptbn2 UTSW 19 4748123 nonsense probably null
R0742:Sptbn2 UTSW 19 4718983 missense possibly damaging 0.46
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1364:Sptbn2 UTSW 19 4732665 missense probably damaging 1.00
R1495:Sptbn2 UTSW 19 4718976 missense possibly damaging 0.92
R1498:Sptbn2 UTSW 19 4744246 missense possibly damaging 0.94
R1606:Sptbn2 UTSW 19 4750242 critical splice donor site probably null
R1678:Sptbn2 UTSW 19 4750497 missense probably damaging 1.00
R1746:Sptbn2 UTSW 19 4745964 nonsense probably null
R1820:Sptbn2 UTSW 19 4726596 missense probably damaging 0.98
R1830:Sptbn2 UTSW 19 4732541 missense probably benign 0.09
R1863:Sptbn2 UTSW 19 4732685 missense possibly damaging 0.54
R1967:Sptbn2 UTSW 19 4745299 missense probably benign 0.00
R2085:Sptbn2 UTSW 19 4738559 missense probably benign 0.09
R2301:Sptbn2 UTSW 19 4734138 missense probably benign 0.00
R2310:Sptbn2 UTSW 19 4718935 missense probably benign 0.19
R2888:Sptbn2 UTSW 19 4748636 missense possibly damaging 0.52
R3788:Sptbn2 UTSW 19 4745922 missense probably damaging 1.00
R4429:Sptbn2 UTSW 19 4738355 missense probably damaging 1.00
R4536:Sptbn2 UTSW 19 4732602 missense probably damaging 1.00
R4662:Sptbn2 UTSW 19 4739239 missense probably damaging 1.00
R4672:Sptbn2 UTSW 19 4732496 missense probably benign 0.25
R4731:Sptbn2 UTSW 19 4742480 missense probably damaging 0.96
R4747:Sptbn2 UTSW 19 4748154 missense probably benign 0.27
R4889:Sptbn2 UTSW 19 4729430 missense possibly damaging 0.69
R4891:Sptbn2 UTSW 19 4738469 missense probably damaging 1.00
R4965:Sptbn2 UTSW 19 4729309 missense probably benign 0.13
R4968:Sptbn2 UTSW 19 4729202 splice site probably null
R4981:Sptbn2 UTSW 19 4751658 missense probably benign 0.22
R5159:Sptbn2 UTSW 19 4737857 missense probably benign 0.12
R5202:Sptbn2 UTSW 19 4724184 missense probably damaging 1.00
R5253:Sptbn2 UTSW 19 4750082 missense probably benign 0.01
R5294:Sptbn2 UTSW 19 4718908 missense possibly damaging 0.67
R5465:Sptbn2 UTSW 19 4750105 missense probably benign 0.00
R5546:Sptbn2 UTSW 19 4725950 missense probably damaging 1.00
R5593:Sptbn2 UTSW 19 4748947 missense probably damaging 1.00
R5780:Sptbn2 UTSW 19 4724667 missense probably damaging 1.00
R5835:Sptbn2 UTSW 19 4738219 missense probably damaging 1.00
R6008:Sptbn2 UTSW 19 4739278 missense possibly damaging 0.89
R6108:Sptbn2 UTSW 19 4731392 critical splice donor site probably null
R6236:Sptbn2 UTSW 19 4748138 missense probably benign 0.01
R6307:Sptbn2 UTSW 19 4724646 missense probably damaging 1.00
R6383:Sptbn2 UTSW 19 4732496 missense possibly damaging 0.89
R6397:Sptbn2 UTSW 19 4742418 missense possibly damaging 0.91
R6453:Sptbn2 UTSW 19 4744180 missense possibly damaging 0.67
R6561:Sptbn2 UTSW 19 4747926 missense probably benign 0.39
R6564:Sptbn2 UTSW 19 4732024 missense probably damaging 1.00
R6644:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R6703:Sptbn2 UTSW 19 4749814 missense probably benign
R6703:Sptbn2 UTSW 19 4749815 missense probably benign
R6753:Sptbn2 UTSW 19 4747785 missense probably benign 0.01
R7007:Sptbn2 UTSW 19 4744145 missense possibly damaging 0.82
R7131:Sptbn2 UTSW 19 4749460 missense probably null
R7219:Sptbn2 UTSW 19 4724173 missense probably damaging 1.00
R7285:Sptbn2 UTSW 19 4737443 missense probably benign 0.00
R7308:Sptbn2 UTSW 19 4751574 missense probably benign
R7469:Sptbn2 UTSW 19 4745118 missense probably benign 0.00
R7502:Sptbn2 UTSW 19 4748082 missense probably benign 0.02
R7623:Sptbn2 UTSW 19 4726168 missense probably damaging 1.00
R7635:Sptbn2 UTSW 19 4744207 missense probably damaging 1.00
R7733:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7738:Sptbn2 UTSW 19 4724125 missense probably damaging 1.00
R7742:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7767:Sptbn2 UTSW 19 4734143 missense possibly damaging 0.62
R7795:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7796:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7871:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7877:Sptbn2 UTSW 19 4744262 missense possibly damaging 0.93
R7920:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7921:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7923:Sptbn2 UTSW 19 4746799 missense probably benign 0.01
R8137:Sptbn2 UTSW 19 4737403 missense possibly damaging 0.81
R8305:Sptbn2 UTSW 19 4729130 missense possibly damaging 0.81
R8695:Sptbn2 UTSW 19 4746696 missense possibly damaging 0.86
R8790:Sptbn2 UTSW 19 4732024 missense probably damaging 1.00
R9125:Sptbn2 UTSW 19 4734213 missense probably benign 0.04
R9483:Sptbn2 UTSW 19 4739946 missense probably damaging 1.00
R9620:Sptbn2 UTSW 19 4750507 missense probably damaging 0.99
R9646:Sptbn2 UTSW 19 4745313 missense probably damaging 1.00
R9694:Sptbn2 UTSW 19 4750507 missense probably damaging 0.99
V7580:Sptbn2 UTSW 19 4750632 missense probably damaging 1.00
Z1176:Sptbn2 UTSW 19 4738205 missense probably damaging 1.00
Z1176:Sptbn2 UTSW 19 4745191 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GATCTGGAAGCTATCTCTGCCC -3'
(R):5'- TGTCTGAGGAAGAGGCACTG -3'

Sequencing Primer
(F):5'- AAGCTATCTCTGCCCGGGTG -3'
(R):5'- GATCAGCCTGGTCTCTGGTCAC -3'
Posted On 2022-09-12