Incidental Mutation 'R9632:Gm597'
ID 725541
Institutional Source Beutler Lab
Gene Symbol Gm597
Ensembl Gene ENSMUSG00000048411
Gene Name predicted gene 597
Synonyms LOC210962
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R9632 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 28776117-28780252 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 28778039 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 304 (Y304F)
Ref Sequence ENSEMBL: ENSMUSP00000058140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059937]
AlphaFold E9Q8J5
Predicted Effect probably benign
Transcript: ENSMUST00000059937
AA Change: Y304F

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000058140
Gene: ENSMUSG00000048411
AA Change: Y304F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 112 129 N/A INTRINSIC
Pfam:FAM75 137 472 8.1e-14 PFAM
low complexity region 664 675 N/A INTRINSIC
internal_repeat_1 718 807 1.4e-5 PROSPERO
internal_repeat_1 807 894 1.4e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,142,301 I554V probably benign Het
Acly A G 11: 100,498,246 I570T probably damaging Het
Adamtsl4 G A 3: 95,681,780 T447I probably damaging Het
Ahcyl1 T A 3: 107,671,178 I248F possibly damaging Het
Arhgef2 T C 3: 88,621,269 I4T probably benign Het
Bin2 T C 15: 100,652,034 D176G possibly damaging Het
Bptf T A 11: 107,061,719 T2166S probably damaging Het
Cachd1 T A 4: 100,974,895 N751K probably benign Het
CN725425 A T 15: 91,242,648 T214S possibly damaging Het
Crtam A T 9: 40,984,375 D218E probably benign Het
Ctsj C T 13: 61,004,014 M76I probably benign Het
Cuedc1 C A 11: 88,170,129 S99R possibly damaging Het
Cyp4a14 T A 4: 115,492,150 I238F probably benign Het
Dnajb11 A T 16: 22,862,594 I41F probably damaging Het
Drd3 A G 16: 43,822,772 N425S probably damaging Het
Eci1 G C 17: 24,426,885 G25R probably damaging Het
Etl4 A T 2: 20,661,938 N52I probably benign Het
Fbxo34 T C 14: 47,531,267 Y746H probably damaging Het
Fndc1 T C 17: 7,772,790 I691M unknown Het
Fut8 A G 12: 77,393,733 T165A probably benign Het
Galr1 A T 18: 82,405,978 L58Q probably damaging Het
Gatsl3 A G 11: 4,219,015 K61E probably benign Het
Glt28d2 T C 3: 85,871,752 D138G probably benign Het
Gm11595 A T 11: 99,772,271 C194* probably null Het
Gm14403 T A 2: 177,509,628 N213K probably benign Het
Gm884 T A 11: 103,542,426 S3306C unknown Het
Gmpr T C 13: 45,546,043 V343A probably benign Het
Hacd1 T C 2: 14,035,867 N152D possibly damaging Het
Hcn1 A G 13: 117,873,986 S367G probably benign Het
Impg1 A G 9: 80,379,994 V390A probably benign Het
Itpr1 T C 6: 108,405,520 C1458R possibly damaging Het
Kif16b A T 2: 142,712,040 V946E probably benign Het
Krt71 T C 15: 101,736,553 E441G probably damaging Het
Lhcgr A G 17: 88,742,104 F665L probably benign Het
Lzic T A 4: 149,488,684 F98I probably damaging Het
Map3k8 A T 18: 4,339,546 V275D probably damaging Het
March8 C T 6: 116,401,444 T113I possibly damaging Het
Mmp15 A G 8: 95,372,103 probably null Het
Mpst A G 15: 78,410,269 D67G probably damaging Het
Nanog T C 6: 122,707,840 S20P probably benign Het
Ndufc2 T C 7: 97,406,895 S67P probably damaging Het
Nrg1 T C 8: 31,917,593 K204R possibly damaging Het
Nsf T A 11: 103,823,768 K728N probably damaging Het
Nutm2 C A 13: 50,474,865 P655H probably benign Het
Obscn G A 11: 59,052,571 R4251C probably benign Het
Olfr1189 A T 2: 88,592,713 Q303L probably benign Het
Olfr1225 T C 2: 89,171,408 probably benign Het
Olfr1234 T C 2: 89,362,721 Y236C probably damaging Het
Olfr683 T A 7: 105,143,958 T112S probably benign Het
Olfr749 C T 14: 50,736,742 C140Y probably benign Het
Olfr979 A T 9: 40,000,876 M117K probably damaging Het
Otog A T 7: 46,265,719 Q836L probably benign Het
Pcdhb11 T C 18: 37,422,966 F450L probably damaging Het
Pelp1 T C 11: 70,394,009 E1011G unknown Het
Pfkfb3 T G 2: 11,481,298 R459S probably benign Het
Pgm2 T C 4: 99,986,721 L567P probably damaging Het
Phf2 T A 13: 48,817,816 D460V unknown Het
Pou5f1 G A 17: 35,508,834 probably benign Het
Pou6f2 T C 13: 18,125,263 R604G Het
Pramel5 T A 4: 144,272,975 I181F probably benign Het
Ptprc T C 1: 138,080,889 R687G probably damaging Het
Ptprz1 T A 6: 23,007,293 H1618Q probably damaging Het
Qars G A 9: 108,514,383 D618N probably damaging Het
Ripply3 A G 16: 94,333,280 T68A probably benign Het
Rrad A G 8: 104,629,688 M160T probably benign Het
Rtn1 A G 12: 72,304,187 V416A probably damaging Het
Rttn A G 18: 89,017,210 N736S possibly damaging Het
Sash1 A T 10: 8,740,205 V631E probably damaging Het
Selenof T A 3: 144,577,609 F33L probably benign Het
Serpinb6b A T 13: 32,971,549 N82Y possibly damaging Het
Sez6 G A 11: 77,974,295 E623K possibly damaging Het
Shpk G T 11: 73,213,412 R129L probably damaging Het
Slc2a10 A C 2: 165,516,256 I434L probably damaging Het
Slc30a6 G T 17: 74,423,064 M316I probably benign Het
Slx4 A T 16: 3,986,105 H948Q probably benign Het
Sncaip A G 18: 52,906,654 E640G probably damaging Het
Sox7 G A 14: 63,948,060 A182T probably benign Het
Srcin1 A G 11: 97,551,822 I60T probably benign Het
Srm C T 4: 148,591,582 probably benign Het
Srrt A T 5: 137,298,427 M447K possibly damaging Het
Stam A T 2: 14,117,393 H101L probably damaging Het
Suz12 C T 11: 80,024,922 T407M possibly damaging Het
Tbc1d10b A G 7: 127,207,864 V167A probably benign Het
Trav16 T A 14: 53,743,453 V33E possibly damaging Het
Tshr C T 12: 91,537,635 P449L probably damaging Het
Ttc17 A G 2: 94,378,752 V119A probably damaging Het
Ttc19 A G 11: 62,313,171 I319M probably benign Het
Ttc6 A G 12: 57,617,513 M351V probably benign Het
Ttn G A 2: 76,884,553 R8026* probably null Het
Ttn A T 2: 76,919,866 V3613E probably benign Het
Twistnb G A 12: 33,429,724 G24R possibly damaging Het
Txndc16 T C 14: 45,163,010 I345V probably benign Het
Ube3b T C 5: 114,415,309 I914T probably benign Het
Vmn1r73 T C 7: 11,756,480 F75S possibly damaging Het
Vmn2r54 A T 7: 12,629,826 M380K possibly damaging Het
Zfp820 T C 17: 21,819,126 Y407C probably damaging Het
Zic5 C T 14: 122,464,375 A315T unknown Het
Zmiz1 C A 14: 25,662,987 D1053E unknown Het
Other mutations in Gm597
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Gm597 APN 1 28778651 missense possibly damaging 0.94
IGL00885:Gm597 APN 1 28776845 missense unknown
IGL01296:Gm597 APN 1 28777056 missense probably benign 0.23
IGL01476:Gm597 APN 1 28777453 missense probably benign 0.04
IGL02125:Gm597 APN 1 28776338 missense possibly damaging 0.91
IGL02410:Gm597 APN 1 28778631 missense probably benign 0.25
IGL02982:Gm597 APN 1 28778054 missense probably damaging 1.00
IGL03031:Gm597 APN 1 28778583 missense probably benign 0.03
IGL03267:Gm597 APN 1 28777121 missense probably damaging 1.00
R0294:Gm597 UTSW 1 28778663 missense probably benign 0.00
R0433:Gm597 UTSW 1 28777342 nonsense probably null
R0485:Gm597 UTSW 1 28778142 missense probably damaging 1.00
R0645:Gm597 UTSW 1 28776930 missense probably damaging 0.99
R0744:Gm597 UTSW 1 28777821 missense possibly damaging 0.46
R0836:Gm597 UTSW 1 28777821 missense possibly damaging 0.46
R1036:Gm597 UTSW 1 28777802 missense probably benign 0.01
R1302:Gm597 UTSW 1 28776340 missense probably benign 0.00
R1394:Gm597 UTSW 1 28776809 missense possibly damaging 0.61
R1395:Gm597 UTSW 1 28776809 missense possibly damaging 0.61
R1514:Gm597 UTSW 1 28778748 missense possibly damaging 0.83
R1535:Gm597 UTSW 1 28777424 missense probably damaging 1.00
R2004:Gm597 UTSW 1 28777179 missense probably damaging 1.00
R2021:Gm597 UTSW 1 28778153 missense probably damaging 0.98
R2022:Gm597 UTSW 1 28778153 missense probably damaging 0.98
R3115:Gm597 UTSW 1 28776329 missense possibly damaging 0.92
R3615:Gm597 UTSW 1 28776575 missense probably benign 0.26
R3616:Gm597 UTSW 1 28776575 missense probably benign 0.26
R3862:Gm597 UTSW 1 28777641 missense probably damaging 0.98
R4067:Gm597 UTSW 1 28777631 missense probably damaging 0.98
R4119:Gm597 UTSW 1 28777973 missense probably damaging 0.99
R4415:Gm597 UTSW 1 28777133 missense probably benign 0.01
R5010:Gm597 UTSW 1 28777862 missense possibly damaging 0.52
R5109:Gm597 UTSW 1 28777555 missense possibly damaging 0.46
R5122:Gm597 UTSW 1 28780060 missense probably benign 0.00
R5533:Gm597 UTSW 1 28778082 missense probably damaging 1.00
R6085:Gm597 UTSW 1 28778227 missense possibly damaging 0.55
R6116:Gm597 UTSW 1 28778699 missense probably benign 0.01
R6750:Gm597 UTSW 1 28777414 missense probably damaging 0.98
R6757:Gm597 UTSW 1 28780110 missense probably damaging 0.98
R6774:Gm597 UTSW 1 28776893 missense probably benign 0.00
R7156:Gm597 UTSW 1 28776767 missense possibly damaging 0.53
R7365:Gm597 UTSW 1 28780152 missense probably benign 0.04
R7739:Gm597 UTSW 1 28777608 missense possibly damaging 0.72
R7996:Gm597 UTSW 1 28778406 missense probably damaging 0.98
R8082:Gm597 UTSW 1 28777498 missense probably benign 0.08
R8281:Gm597 UTSW 1 28778144 missense possibly damaging 0.77
R8514:Gm597 UTSW 1 28778505 missense probably damaging 1.00
R8944:Gm597 UTSW 1 28777074 missense probably benign 0.00
R9042:Gm597 UTSW 1 28776956 missense possibly damaging 0.72
R9101:Gm597 UTSW 1 28776659 missense probably benign 0.04
R9106:Gm597 UTSW 1 28776894 missense probably benign 0.00
R9173:Gm597 UTSW 1 28777349 missense probably benign 0.22
R9596:Gm597 UTSW 1 28776607 missense probably benign 0.07
R9656:Gm597 UTSW 1 28777455 missense probably benign 0.02
R9659:Gm597 UTSW 1 28777455 missense probably benign 0.02
R9661:Gm597 UTSW 1 28777455 missense probably benign 0.02
R9663:Gm597 UTSW 1 28777455 missense probably benign 0.02
R9710:Gm597 UTSW 1 28778039 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- AAGAGCATCCCTGTGAGTTCG -3'
(R):5'- CCTTCGCAACACTGATATAGGG -3'

Sequencing Primer
(F):5'- GAGTTCGGACCCCACCATCTTG -3'
(R):5'- TTCGCAACACTGATATAGGGATACAG -3'
Posted On 2022-09-12