Incidental Mutation 'R0764:Ddx49'
ID72556
Institutional Source Beutler Lab
Gene Symbol Ddx49
Ensembl Gene ENSMUSG00000057788
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 49
SynonymsR27090_2
MMRRC Submission 038944-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R0764 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location70292866-70302489 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70297257 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 170 (E170G)
Ref Sequence ENSEMBL: ENSMUSP00000008004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003669] [ENSMUST00000008004] [ENSMUST00000110124] [ENSMUST00000140212]
Predicted Effect probably benign
Transcript: ENSMUST00000003669
SMART Domains Protein: ENSMUSP00000003669
Gene: ENSMUSG00000003573

DomainStartEndE-ValueType
WH1 4 110 4.92e-37 SMART
low complexity region 198 210 N/A INTRINSIC
PDB:3CVF|D 285 342 2e-10 PDB
low complexity region 343 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000008004
AA Change: E170G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000008004
Gene: ENSMUSG00000057788
AA Change: E170G

DomainStartEndE-ValueType
DEXDc 21 222 1.85e-57 SMART
HELICc 262 343 2.41e-29 SMART
low complexity region 369 383 N/A INTRINSIC
low complexity region 461 470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110124
SMART Domains Protein: ENSMUSP00000105751
Gene: ENSMUSG00000003573

DomainStartEndE-ValueType
WH1 4 110 4.92e-37 SMART
low complexity region 198 210 N/A INTRINSIC
PDB:3CVF|D 285 342 2e-10 PDB
low complexity region 343 358 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127094
Predicted Effect probably benign
Transcript: ENSMUST00000135368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138688
Predicted Effect probably benign
Transcript: ENSMUST00000140212
SMART Domains Protein: ENSMUSP00000117033
Gene: ENSMUSG00000003573

DomainStartEndE-ValueType
WH1 4 110 4.92e-37 SMART
low complexity region 198 210 N/A INTRINSIC
PDB:3CVF|D 282 339 2e-10 PDB
low complexity region 340 355 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144890
Meta Mutation Damage Score 0.1642 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.1%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,059,946 Y898N probably damaging Het
Acp4 T C 7: 44,252,314 probably benign Het
Adipor2 T C 6: 119,357,254 I332V probably benign Het
Ago3 T A 4: 126,355,092 K555N possibly damaging Het
Angpt4 A G 2: 151,911,284 probably benign Het
Ano5 G T 7: 51,537,842 probably benign Het
Ap3b1 C T 13: 94,479,879 probably benign Het
BC025446 T A 15: 75,220,723 F97Y probably benign Het
Cbl A T 9: 44,164,152 C399S probably damaging Het
Cdkl2 C A 5: 92,020,277 V353L probably benign Het
Celsr3 A G 9: 108,827,818 Y500C probably damaging Het
Cep162 A G 9: 87,201,745 S1242P probably damaging Het
Crhr1 C T 11: 104,159,326 R66W probably damaging Het
Fam193a T C 5: 34,443,341 F305L probably damaging Het
Fam76a C T 4: 132,910,699 G198R probably damaging Het
Gm43302 T A 5: 105,280,489 I130F probably benign Het
Hectd4 T A 5: 121,286,769 I745N possibly damaging Het
Ina T A 19: 47,023,648 *502K probably null Het
Kdm1b A T 13: 47,068,603 D506V possibly damaging Het
Lrrk2 A G 15: 91,775,046 probably null Het
Naip5 A T 13: 100,217,105 D1215E probably benign Het
Neb A G 2: 52,216,867 probably benign Het
Nectin2 T A 7: 19,749,171 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1243 A G 2: 89,527,996 V138A probably benign Het
Olfr170 G T 16: 19,606,432 P79T probably damaging Het
Osbp A G 19: 11,984,156 probably benign Het
Otog A G 7: 46,300,494 D2460G probably benign Het
Pcgf1 T C 6: 83,079,169 C2R probably damaging Het
Per2 C T 1: 91,429,420 V674M probably damaging Het
Pias3 C T 3: 96,701,295 P218S probably damaging Het
Plod3 C T 5: 136,989,583 probably benign Het
Purb C T 11: 6,475,661 V76M probably damaging Het
Ranbp1 C A 16: 18,240,158 E181* probably null Het
Rit2 T C 18: 31,153,701 probably benign Het
Rnf103 C A 6: 71,509,582 T399K probably damaging Het
Slc22a13 T C 9: 119,208,680 probably null Het
Slc35f4 T A 14: 49,306,339 probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tnfrsf17 C T 16: 11,315,199 T47M possibly damaging Het
Tram1 A G 1: 13,579,709 I97T probably damaging Het
Ttc38 T C 15: 85,846,403 probably benign Het
Zfp113 T A 5: 138,145,244 Q248L probably damaging Het
Other mutations in Ddx49
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Ddx49 APN 8 70294756 nonsense probably null
IGL02630:Ddx49 APN 8 70301018 missense probably damaging 1.00
R0306:Ddx49 UTSW 8 70294672 unclassified probably benign
R0394:Ddx49 UTSW 8 70296925 missense probably damaging 0.97
R0421:Ddx49 UTSW 8 70295632 missense probably damaging 1.00
R0524:Ddx49 UTSW 8 70296924 missense probably damaging 0.98
R1051:Ddx49 UTSW 8 70294685 critical splice donor site probably null
R1852:Ddx49 UTSW 8 70300983 missense probably damaging 1.00
R2008:Ddx49 UTSW 8 70295444 missense probably damaging 1.00
R6216:Ddx49 UTSW 8 70297284 missense probably damaging 1.00
R7085:Ddx49 UTSW 8 70302483 unclassified probably benign
R7102:Ddx49 UTSW 8 70301076 missense probably damaging 1.00
R7648:Ddx49 UTSW 8 70297955 missense possibly damaging 0.95
R8126:Ddx49 UTSW 8 70295596 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGATGATGGAGCAGTCCTCCAGC -3'
(R):5'- GTGTCTGAAAGGCAGGTAGGCTATG -3'

Sequencing Primer
(F):5'- GAAGGGCAGAGCATTCTACCTC -3'
(R):5'- AGGCTATGCTTGGGGCTTTTAC -3'
Posted On2013-09-30