Incidental Mutation 'R9632:Cyp4a14'
ID 725563
Institutional Source Beutler Lab
Gene Symbol Cyp4a14
Ensembl Gene ENSMUSG00000028715
Gene Name cytochrome P450, family 4, subfamily a, polypeptide 14
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R9632 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 115343397-115353339 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 115349347 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 238 (I238F)
Ref Sequence ENSEMBL: ENSMUSP00000030487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030487]
AlphaFold O35728
Predicted Effect probably benign
Transcript: ENSMUST00000030487
AA Change: I238F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000030487
Gene: ENSMUSG00000028715
AA Change: I238F

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 503 5.4e-129 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for disruption of this gene display high blood pressure. Blood pressure is elevated in females as well to levels comparable to normotensive males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly A G 11: 100,389,072 (GRCm39) I570T probably damaging Het
Adamtsl4 G A 3: 95,589,090 (GRCm39) T447I probably damaging Het
Ahcyl1 T A 3: 107,578,494 (GRCm39) I248F possibly damaging Het
Arhgef2 T C 3: 88,528,576 (GRCm39) I4T probably benign Het
Bin2 T C 15: 100,549,915 (GRCm39) D176G possibly damaging Het
Bptf T A 11: 106,952,545 (GRCm39) T2166S probably damaging Het
Cachd1 T A 4: 100,832,092 (GRCm39) N751K probably benign Het
Castor1 A G 11: 4,169,015 (GRCm39) K61E probably benign Het
CN725425 A T 15: 91,126,851 (GRCm39) T214S possibly damaging Het
Crtam A T 9: 40,895,671 (GRCm39) D218E probably benign Het
Ctsj C T 13: 61,151,828 (GRCm39) M76I probably benign Het
Cuedc1 C A 11: 88,060,955 (GRCm39) S99R possibly damaging Het
Dnajb11 A T 16: 22,681,344 (GRCm39) I41F probably damaging Het
Drd3 A G 16: 43,643,135 (GRCm39) N425S probably damaging Het
Eci1 G C 17: 24,645,859 (GRCm39) G25R probably damaging Het
Etl4 A T 2: 20,666,749 (GRCm39) N52I probably benign Het
Fbxo34 T C 14: 47,768,724 (GRCm39) Y746H probably damaging Het
Fcgbpl1 A G 7: 27,841,726 (GRCm39) I554V probably benign Het
Fndc1 T C 17: 7,991,622 (GRCm39) I691M unknown Het
Fut8 A G 12: 77,440,507 (GRCm39) T165A probably benign Het
Galr1 A T 18: 82,424,103 (GRCm39) L58Q probably damaging Het
Glt28d2 T C 3: 85,779,059 (GRCm39) D138G probably benign Het
Gm11595 A T 11: 99,663,097 (GRCm39) C194* probably null Het
Gm14403 T A 2: 177,201,421 (GRCm39) N213K probably benign Het
Gmpr T C 13: 45,699,519 (GRCm39) V343A probably benign Het
Hacd1 T C 2: 14,040,678 (GRCm39) N152D possibly damaging Het
Hcn1 A G 13: 118,010,522 (GRCm39) S367G probably benign Het
Impg1 A G 9: 80,287,276 (GRCm39) V390A probably benign Het
Itpr1 T C 6: 108,382,481 (GRCm39) C1458R possibly damaging Het
Kif16b A T 2: 142,553,960 (GRCm39) V946E probably benign Het
Krt71 T C 15: 101,644,988 (GRCm39) E441G probably damaging Het
Lhcgr A G 17: 89,049,532 (GRCm39) F665L probably benign Het
Lrrc37 T A 11: 103,433,252 (GRCm39) S3306C unknown Het
Lzic T A 4: 149,573,141 (GRCm39) F98I probably damaging Het
Map3k8 A T 18: 4,339,546 (GRCm39) V275D probably damaging Het
Marchf8 C T 6: 116,378,405 (GRCm39) T113I possibly damaging Het
Mmp15 A G 8: 96,098,731 (GRCm39) probably null Het
Mpst A G 15: 78,294,469 (GRCm39) D67G probably damaging Het
Nanog T C 6: 122,684,799 (GRCm39) S20P probably benign Het
Ndufc2 T C 7: 97,056,102 (GRCm39) S67P probably damaging Het
Nrg1 T C 8: 32,407,621 (GRCm39) K204R possibly damaging Het
Nsf T A 11: 103,714,594 (GRCm39) K728N probably damaging Het
Nutm2 C A 13: 50,628,901 (GRCm39) P655H probably benign Het
Obscn G A 11: 58,943,397 (GRCm39) R4251C probably benign Het
Or10g9 A T 9: 39,912,172 (GRCm39) M117K probably damaging Het
Or11h4 C T 14: 50,974,199 (GRCm39) C140Y probably benign Het
Or4a15 T C 2: 89,193,065 (GRCm39) Y236C probably damaging Het
Or4c102 A T 2: 88,423,057 (GRCm39) Q303L probably benign Het
Or4c120 T C 2: 89,001,752 (GRCm39) probably benign Het
Or56a5 T A 7: 104,793,165 (GRCm39) T112S probably benign Het
Otog A T 7: 45,915,143 (GRCm39) Q836L probably benign Het
Pcdhb11 T C 18: 37,556,019 (GRCm39) F450L probably damaging Het
Pelp1 T C 11: 70,284,835 (GRCm39) E1011G unknown Het
Pfkfb3 T G 2: 11,486,109 (GRCm39) R459S probably benign Het
Pgm1 T C 4: 99,843,918 (GRCm39) L567P probably damaging Het
Phf2 T A 13: 48,971,292 (GRCm39) D460V unknown Het
Polr1f G A 12: 33,479,723 (GRCm39) G24R possibly damaging Het
Pou5f1 G A 17: 35,819,731 (GRCm39) probably benign Het
Pou6f2 T C 13: 18,299,848 (GRCm39) R604G Het
Pramel5 T A 4: 143,999,545 (GRCm39) I181F probably benign Het
Ptprc T C 1: 138,008,627 (GRCm39) R687G probably damaging Het
Ptprz1 T A 6: 23,007,292 (GRCm39) H1618Q probably damaging Het
Qars1 G A 9: 108,391,582 (GRCm39) D618N probably damaging Het
Ripply3 A G 16: 94,134,139 (GRCm39) T68A probably benign Het
Rrad A G 8: 105,356,320 (GRCm39) M160T probably benign Het
Rtn1 A G 12: 72,350,961 (GRCm39) V416A probably damaging Het
Rttn A G 18: 89,035,334 (GRCm39) N736S possibly damaging Het
Sash1 A T 10: 8,615,969 (GRCm39) V631E probably damaging Het
Selenof T A 3: 144,283,370 (GRCm39) F33L probably benign Het
Serpinb6b A T 13: 33,155,532 (GRCm39) N82Y possibly damaging Het
Sez6 G A 11: 77,865,121 (GRCm39) E623K possibly damaging Het
Shpk G T 11: 73,104,238 (GRCm39) R129L probably damaging Het
Slc2a10 A C 2: 165,358,176 (GRCm39) I434L probably damaging Het
Slc30a6 G T 17: 74,730,059 (GRCm39) M316I probably benign Het
Slx4 A T 16: 3,803,969 (GRCm39) H948Q probably benign Het
Sncaip A G 18: 53,039,726 (GRCm39) E640G probably damaging Het
Sox7 G A 14: 64,185,509 (GRCm39) A182T probably benign Het
Spata31e5 T A 1: 28,817,120 (GRCm39) Y304F probably benign Het
Srcin1 A G 11: 97,442,648 (GRCm39) I60T probably benign Het
Srm C T 4: 148,676,039 (GRCm39) probably benign Het
Srrt A T 5: 137,296,689 (GRCm39) M447K possibly damaging Het
Stam A T 2: 14,122,204 (GRCm39) H101L probably damaging Het
Suz12 C T 11: 79,915,748 (GRCm39) T407M possibly damaging Het
Tbc1d10b A G 7: 126,807,036 (GRCm39) V167A probably benign Het
Trav16 T A 14: 53,980,910 (GRCm39) V33E possibly damaging Het
Tshr C T 12: 91,504,409 (GRCm39) P449L probably damaging Het
Ttc17 A G 2: 94,209,097 (GRCm39) V119A probably damaging Het
Ttc19 A G 11: 62,203,997 (GRCm39) I319M probably benign Het
Ttc6 A G 12: 57,664,299 (GRCm39) M351V probably benign Het
Ttn G A 2: 76,714,897 (GRCm39) R8026* probably null Het
Ttn A T 2: 76,750,210 (GRCm39) V3613E probably benign Het
Txndc16 T C 14: 45,400,467 (GRCm39) I345V probably benign Het
Ube3b T C 5: 114,553,370 (GRCm39) I914T probably benign Het
Vmn1r73 T C 7: 11,490,407 (GRCm39) F75S possibly damaging Het
Vmn2r54 A T 7: 12,363,753 (GRCm39) M380K possibly damaging Het
Zfp820 T C 17: 22,038,107 (GRCm39) Y407C probably damaging Het
Zic5 C T 14: 122,701,787 (GRCm39) A315T unknown Het
Zmiz1 C A 14: 25,663,411 (GRCm39) D1053E unknown Het
Other mutations in Cyp4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Cyp4a14 APN 4 115,347,149 (GRCm39) splice site probably benign
IGL01539:Cyp4a14 APN 4 115,344,374 (GRCm39) missense possibly damaging 0.71
IGL01802:Cyp4a14 APN 4 115,352,134 (GRCm39) nonsense probably null
IGL02309:Cyp4a14 APN 4 115,348,829 (GRCm39) missense probably damaging 0.99
IGL02330:Cyp4a14 APN 4 115,352,224 (GRCm39) splice site probably benign
IGL03302:Cyp4a14 APN 4 115,348,575 (GRCm39) missense probably benign 0.00
R1037:Cyp4a14 UTSW 4 115,347,193 (GRCm39) missense probably damaging 1.00
R1236:Cyp4a14 UTSW 4 115,349,367 (GRCm39) missense probably benign 0.01
R2132:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2133:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2873:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R4015:Cyp4a14 UTSW 4 115,348,331 (GRCm39) missense probably damaging 1.00
R4925:Cyp4a14 UTSW 4 115,353,133 (GRCm39) missense possibly damaging 0.68
R5104:Cyp4a14 UTSW 4 115,353,126 (GRCm39) missense probably damaging 1.00
R5135:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R5150:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R5930:Cyp4a14 UTSW 4 115,348,607 (GRCm39) missense probably damaging 1.00
R5997:Cyp4a14 UTSW 4 115,353,297 (GRCm39) nonsense probably null
R6269:Cyp4a14 UTSW 4 115,348,328 (GRCm39) missense possibly damaging 0.87
R6354:Cyp4a14 UTSW 4 115,344,441 (GRCm39) missense probably damaging 1.00
R6377:Cyp4a14 UTSW 4 115,353,280 (GRCm39) missense probably benign 0.01
R6534:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R6563:Cyp4a14 UTSW 4 115,349,283 (GRCm39) missense probably benign 0.23
R6751:Cyp4a14 UTSW 4 115,348,391 (GRCm39) missense probably damaging 0.99
R7039:Cyp4a14 UTSW 4 115,348,278 (GRCm39) missense probably benign 0.23
R7125:Cyp4a14 UTSW 4 115,348,358 (GRCm39) missense probably damaging 1.00
R7379:Cyp4a14 UTSW 4 115,350,907 (GRCm39) splice site probably null
R7544:Cyp4a14 UTSW 4 115,348,283 (GRCm39) missense probably damaging 0.98
R7591:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R7740:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R7741:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R7753:Cyp4a14 UTSW 4 115,350,861 (GRCm39) missense probably damaging 1.00
R7789:Cyp4a14 UTSW 4 115,352,107 (GRCm39) missense probably benign 0.00
R8064:Cyp4a14 UTSW 4 115,352,155 (GRCm39) missense probably benign
R8311:Cyp4a14 UTSW 4 115,348,275 (GRCm39) missense probably damaging 1.00
R8458:Cyp4a14 UTSW 4 115,353,129 (GRCm39) missense probably damaging 1.00
R8868:Cyp4a14 UTSW 4 115,348,553 (GRCm39) missense probably damaging 1.00
R9039:Cyp4a14 UTSW 4 115,344,461 (GRCm39) missense probably damaging 0.97
R9710:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
Z1176:Cyp4a14 UTSW 4 115,347,214 (GRCm39) missense probably benign 0.01
Z1177:Cyp4a14 UTSW 4 115,348,650 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ATACCTCAAGCCCTGCAGAG -3'
(R):5'- CCATGGTCAAATGATCTTGAAGTTG -3'

Sequencing Primer
(F):5'- CAGAGGTGTCTGGTAAACTCATTATG -3'
(R):5'- ATTGTGTGCCCCATGGTCAAAAG -3'
Posted On 2022-09-12