Incidental Mutation 'R9632:Ube3b'
ID 725567
Institutional Source Beutler Lab
Gene Symbol Ube3b
Ensembl Gene ENSMUSG00000029577
Gene Name ubiquitin protein ligase E3B
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9632 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 114518668-114559230 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 114553370 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 914 (I914T)
Ref Sequence ENSEMBL: ENSMUSP00000073652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]
AlphaFold Q9ES34
Predicted Effect probably benign
Transcript: ENSMUST00000074002
AA Change: I914T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: I914T

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
low complexity region 470 488 N/A INTRINSIC
HECTc 697 1070 2.15e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130169
SMART Domains Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196651
SMART Domains Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
HECTc 122 495 1.1e-112 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly A G 11: 100,389,072 (GRCm39) I570T probably damaging Het
Adamtsl4 G A 3: 95,589,090 (GRCm39) T447I probably damaging Het
Ahcyl1 T A 3: 107,578,494 (GRCm39) I248F possibly damaging Het
Arhgef2 T C 3: 88,528,576 (GRCm39) I4T probably benign Het
Bin2 T C 15: 100,549,915 (GRCm39) D176G possibly damaging Het
Bptf T A 11: 106,952,545 (GRCm39) T2166S probably damaging Het
Cachd1 T A 4: 100,832,092 (GRCm39) N751K probably benign Het
Castor1 A G 11: 4,169,015 (GRCm39) K61E probably benign Het
CN725425 A T 15: 91,126,851 (GRCm39) T214S possibly damaging Het
Crtam A T 9: 40,895,671 (GRCm39) D218E probably benign Het
Ctsj C T 13: 61,151,828 (GRCm39) M76I probably benign Het
Cuedc1 C A 11: 88,060,955 (GRCm39) S99R possibly damaging Het
Cyp4a14 T A 4: 115,349,347 (GRCm39) I238F probably benign Het
Dnajb11 A T 16: 22,681,344 (GRCm39) I41F probably damaging Het
Drd3 A G 16: 43,643,135 (GRCm39) N425S probably damaging Het
Eci1 G C 17: 24,645,859 (GRCm39) G25R probably damaging Het
Etl4 A T 2: 20,666,749 (GRCm39) N52I probably benign Het
Fbxo34 T C 14: 47,768,724 (GRCm39) Y746H probably damaging Het
Fcgbpl1 A G 7: 27,841,726 (GRCm39) I554V probably benign Het
Fndc1 T C 17: 7,991,622 (GRCm39) I691M unknown Het
Fut8 A G 12: 77,440,507 (GRCm39) T165A probably benign Het
Galr1 A T 18: 82,424,103 (GRCm39) L58Q probably damaging Het
Glt28d2 T C 3: 85,779,059 (GRCm39) D138G probably benign Het
Gm11595 A T 11: 99,663,097 (GRCm39) C194* probably null Het
Gm14403 T A 2: 177,201,421 (GRCm39) N213K probably benign Het
Gmpr T C 13: 45,699,519 (GRCm39) V343A probably benign Het
Hacd1 T C 2: 14,040,678 (GRCm39) N152D possibly damaging Het
Hcn1 A G 13: 118,010,522 (GRCm39) S367G probably benign Het
Impg1 A G 9: 80,287,276 (GRCm39) V390A probably benign Het
Itpr1 T C 6: 108,382,481 (GRCm39) C1458R possibly damaging Het
Kif16b A T 2: 142,553,960 (GRCm39) V946E probably benign Het
Krt71 T C 15: 101,644,988 (GRCm39) E441G probably damaging Het
Lhcgr A G 17: 89,049,532 (GRCm39) F665L probably benign Het
Lrrc37 T A 11: 103,433,252 (GRCm39) S3306C unknown Het
Lzic T A 4: 149,573,141 (GRCm39) F98I probably damaging Het
Map3k8 A T 18: 4,339,546 (GRCm39) V275D probably damaging Het
Marchf8 C T 6: 116,378,405 (GRCm39) T113I possibly damaging Het
Mmp15 A G 8: 96,098,731 (GRCm39) probably null Het
Mpst A G 15: 78,294,469 (GRCm39) D67G probably damaging Het
Nanog T C 6: 122,684,799 (GRCm39) S20P probably benign Het
Ndufc2 T C 7: 97,056,102 (GRCm39) S67P probably damaging Het
Nrg1 T C 8: 32,407,621 (GRCm39) K204R possibly damaging Het
Nsf T A 11: 103,714,594 (GRCm39) K728N probably damaging Het
Nutm2 C A 13: 50,628,901 (GRCm39) P655H probably benign Het
Obscn G A 11: 58,943,397 (GRCm39) R4251C probably benign Het
Or10g9 A T 9: 39,912,172 (GRCm39) M117K probably damaging Het
Or11h4 C T 14: 50,974,199 (GRCm39) C140Y probably benign Het
Or4a15 T C 2: 89,193,065 (GRCm39) Y236C probably damaging Het
Or4c102 A T 2: 88,423,057 (GRCm39) Q303L probably benign Het
Or4c120 T C 2: 89,001,752 (GRCm39) probably benign Het
Or56a5 T A 7: 104,793,165 (GRCm39) T112S probably benign Het
Otog A T 7: 45,915,143 (GRCm39) Q836L probably benign Het
Pcdhb11 T C 18: 37,556,019 (GRCm39) F450L probably damaging Het
Pelp1 T C 11: 70,284,835 (GRCm39) E1011G unknown Het
Pfkfb3 T G 2: 11,486,109 (GRCm39) R459S probably benign Het
Pgm1 T C 4: 99,843,918 (GRCm39) L567P probably damaging Het
Phf2 T A 13: 48,971,292 (GRCm39) D460V unknown Het
Polr1f G A 12: 33,479,723 (GRCm39) G24R possibly damaging Het
Pou5f1 G A 17: 35,819,731 (GRCm39) probably benign Het
Pou6f2 T C 13: 18,299,848 (GRCm39) R604G Het
Pramel5 T A 4: 143,999,545 (GRCm39) I181F probably benign Het
Ptprc T C 1: 138,008,627 (GRCm39) R687G probably damaging Het
Ptprz1 T A 6: 23,007,292 (GRCm39) H1618Q probably damaging Het
Qars1 G A 9: 108,391,582 (GRCm39) D618N probably damaging Het
Ripply3 A G 16: 94,134,139 (GRCm39) T68A probably benign Het
Rrad A G 8: 105,356,320 (GRCm39) M160T probably benign Het
Rtn1 A G 12: 72,350,961 (GRCm39) V416A probably damaging Het
Rttn A G 18: 89,035,334 (GRCm39) N736S possibly damaging Het
Sash1 A T 10: 8,615,969 (GRCm39) V631E probably damaging Het
Selenof T A 3: 144,283,370 (GRCm39) F33L probably benign Het
Serpinb6b A T 13: 33,155,532 (GRCm39) N82Y possibly damaging Het
Sez6 G A 11: 77,865,121 (GRCm39) E623K possibly damaging Het
Shpk G T 11: 73,104,238 (GRCm39) R129L probably damaging Het
Slc2a10 A C 2: 165,358,176 (GRCm39) I434L probably damaging Het
Slc30a6 G T 17: 74,730,059 (GRCm39) M316I probably benign Het
Slx4 A T 16: 3,803,969 (GRCm39) H948Q probably benign Het
Sncaip A G 18: 53,039,726 (GRCm39) E640G probably damaging Het
Sox7 G A 14: 64,185,509 (GRCm39) A182T probably benign Het
Spata31e5 T A 1: 28,817,120 (GRCm39) Y304F probably benign Het
Srcin1 A G 11: 97,442,648 (GRCm39) I60T probably benign Het
Srm C T 4: 148,676,039 (GRCm39) probably benign Het
Srrt A T 5: 137,296,689 (GRCm39) M447K possibly damaging Het
Stam A T 2: 14,122,204 (GRCm39) H101L probably damaging Het
Suz12 C T 11: 79,915,748 (GRCm39) T407M possibly damaging Het
Tbc1d10b A G 7: 126,807,036 (GRCm39) V167A probably benign Het
Trav16 T A 14: 53,980,910 (GRCm39) V33E possibly damaging Het
Tshr C T 12: 91,504,409 (GRCm39) P449L probably damaging Het
Ttc17 A G 2: 94,209,097 (GRCm39) V119A probably damaging Het
Ttc19 A G 11: 62,203,997 (GRCm39) I319M probably benign Het
Ttc6 A G 12: 57,664,299 (GRCm39) M351V probably benign Het
Ttn G A 2: 76,714,897 (GRCm39) R8026* probably null Het
Ttn A T 2: 76,750,210 (GRCm39) V3613E probably benign Het
Txndc16 T C 14: 45,400,467 (GRCm39) I345V probably benign Het
Vmn1r73 T C 7: 11,490,407 (GRCm39) F75S possibly damaging Het
Vmn2r54 A T 7: 12,363,753 (GRCm39) M380K possibly damaging Het
Zfp820 T C 17: 22,038,107 (GRCm39) Y407C probably damaging Het
Zic5 C T 14: 122,701,787 (GRCm39) A315T unknown Het
Zmiz1 C A 14: 25,663,411 (GRCm39) D1053E unknown Het
Other mutations in Ube3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ube3b APN 5 114,553,348 (GRCm39) missense possibly damaging 0.93
IGL01154:Ube3b APN 5 114,544,313 (GRCm39) missense probably null 0.86
IGL02632:Ube3b APN 5 114,536,902 (GRCm39) missense probably benign
IGL02850:Ube3b APN 5 114,544,310 (GRCm39) missense probably damaging 1.00
IGL02878:Ube3b APN 5 114,542,778 (GRCm39) splice site probably null
IGL02881:Ube3b APN 5 114,550,945 (GRCm39) missense possibly damaging 0.78
R0003:Ube3b UTSW 5 114,536,912 (GRCm39) missense probably benign 0.17
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0111:Ube3b UTSW 5 114,528,437 (GRCm39) splice site probably benign
R0309:Ube3b UTSW 5 114,557,530 (GRCm39) splice site probably benign
R0718:Ube3b UTSW 5 114,540,616 (GRCm39) nonsense probably null
R1344:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1350:Ube3b UTSW 5 114,544,198 (GRCm39) splice site probably null
R1418:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1732:Ube3b UTSW 5 114,525,506 (GRCm39) missense probably benign 0.01
R1764:Ube3b UTSW 5 114,542,678 (GRCm39) missense possibly damaging 0.89
R1975:Ube3b UTSW 5 114,537,926 (GRCm39) missense possibly damaging 0.80
R2014:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2015:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2041:Ube3b UTSW 5 114,525,294 (GRCm39) missense probably damaging 0.99
R2074:Ube3b UTSW 5 114,553,316 (GRCm39) missense probably benign 0.14
R2202:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R2205:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R3826:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3829:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3830:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3927:Ube3b UTSW 5 114,553,741 (GRCm39) missense probably benign 0.03
R3974:Ube3b UTSW 5 114,550,491 (GRCm39) missense probably benign 0.05
R4049:Ube3b UTSW 5 114,550,931 (GRCm39) missense probably benign 0.09
R4096:Ube3b UTSW 5 114,531,147 (GRCm39) missense possibly damaging 0.65
R4261:Ube3b UTSW 5 114,536,489 (GRCm39) missense possibly damaging 0.80
R4415:Ube3b UTSW 5 114,550,505 (GRCm39) missense probably damaging 1.00
R4688:Ube3b UTSW 5 114,531,139 (GRCm39) missense probably benign 0.03
R4779:Ube3b UTSW 5 114,542,778 (GRCm39) splice site probably null
R4824:Ube3b UTSW 5 114,553,787 (GRCm39) splice site probably null
R4868:Ube3b UTSW 5 114,536,488 (GRCm39) missense probably benign 0.00
R4953:Ube3b UTSW 5 114,539,471 (GRCm39) missense probably benign 0.01
R5013:Ube3b UTSW 5 114,545,702 (GRCm39) missense probably damaging 1.00
R5057:Ube3b UTSW 5 114,544,318 (GRCm39) missense probably benign 0.01
R5117:Ube3b UTSW 5 114,557,692 (GRCm39) missense probably damaging 0.96
R5131:Ube3b UTSW 5 114,545,607 (GRCm39) missense probably damaging 1.00
R5498:Ube3b UTSW 5 114,556,635 (GRCm39) missense probably damaging 1.00
R5564:Ube3b UTSW 5 114,527,136 (GRCm39) missense probably damaging 1.00
R5572:Ube3b UTSW 5 114,544,240 (GRCm39) missense probably damaging 0.99
R5580:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R5596:Ube3b UTSW 5 114,544,221 (GRCm39) splice site probably null
R5843:Ube3b UTSW 5 114,550,360 (GRCm39) missense probably damaging 1.00
R5910:Ube3b UTSW 5 114,553,370 (GRCm39) missense possibly damaging 0.63
R6591:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R6691:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R7148:Ube3b UTSW 5 114,544,313 (GRCm39) missense probably damaging 0.97
R7334:Ube3b UTSW 5 114,553,742 (GRCm39) missense possibly damaging 0.64
R7438:Ube3b UTSW 5 114,556,687 (GRCm39) missense probably damaging 1.00
R7438:Ube3b UTSW 5 114,553,345 (GRCm39) missense possibly damaging 0.79
R7640:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R7825:Ube3b UTSW 5 114,539,373 (GRCm39) missense probably damaging 1.00
R7958:Ube3b UTSW 5 114,539,484 (GRCm39) missense probably benign 0.05
R8025:Ube3b UTSW 5 114,546,270 (GRCm39) missense probably damaging 0.99
R8058:Ube3b UTSW 5 114,544,846 (GRCm39) missense possibly damaging 0.58
R8087:Ube3b UTSW 5 114,550,550 (GRCm39) critical splice donor site probably null
R8182:Ube3b UTSW 5 114,530,199 (GRCm39) missense possibly damaging 0.77
R8322:Ube3b UTSW 5 114,540,747 (GRCm39) missense probably benign 0.04
R8465:Ube3b UTSW 5 114,528,451 (GRCm39) missense probably damaging 1.00
R8682:Ube3b UTSW 5 114,550,351 (GRCm39) missense probably damaging 1.00
R8708:Ube3b UTSW 5 114,531,151 (GRCm39) missense probably benign 0.34
R8758:Ube3b UTSW 5 114,553,261 (GRCm39) critical splice acceptor site probably benign
R8784:Ube3b UTSW 5 114,526,800 (GRCm39) missense probably damaging 1.00
R9058:Ube3b UTSW 5 114,553,300 (GRCm39) missense probably benign 0.05
R9072:Ube3b UTSW 5 114,542,607 (GRCm39) missense probably damaging 0.98
R9116:Ube3b UTSW 5 114,542,837 (GRCm39) intron probably benign
R9537:Ube3b UTSW 5 114,525,245 (GRCm39) missense probably damaging 1.00
R9596:Ube3b UTSW 5 114,527,171 (GRCm39) missense probably damaging 1.00
R9710:Ube3b UTSW 5 114,553,370 (GRCm39) missense probably benign 0.00
X0017:Ube3b UTSW 5 114,553,646 (GRCm39) missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GCTCATCTCTTAGCATGCTTGG -3'
(R):5'- AAATGGGCTGTCATCAGGATACC -3'

Sequencing Primer
(F):5'- CCTAGCCAGCTCATCCCAGTG -3'
(R):5'- GGATACCAGAGTCACTCTATGTCAG -3'
Posted On 2022-09-12