Incidental Mutation 'R9632:Ube3b'
ID 725567
Institutional Source Beutler Lab
Gene Symbol Ube3b
Ensembl Gene ENSMUSG00000029577
Gene Name ubiquitin protein ligase E3B
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9632 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 114380607-114421169 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 114415309 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 914 (I914T)
Ref Sequence ENSEMBL: ENSMUSP00000073652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]
AlphaFold Q9ES34
Predicted Effect probably benign
Transcript: ENSMUST00000074002
AA Change: I914T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: I914T

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
low complexity region 470 488 N/A INTRINSIC
HECTc 697 1070 2.15e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130169
SMART Domains Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196651
SMART Domains Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
HECTc 122 495 1.1e-112 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,142,301 I554V probably benign Het
Acly A G 11: 100,498,246 I570T probably damaging Het
Adamtsl4 G A 3: 95,681,780 T447I probably damaging Het
Ahcyl1 T A 3: 107,671,178 I248F possibly damaging Het
Arhgef2 T C 3: 88,621,269 I4T probably benign Het
Bin2 T C 15: 100,652,034 D176G possibly damaging Het
Bptf T A 11: 107,061,719 T2166S probably damaging Het
Cachd1 T A 4: 100,974,895 N751K probably benign Het
CN725425 A T 15: 91,242,648 T214S possibly damaging Het
Crtam A T 9: 40,984,375 D218E probably benign Het
Ctsj C T 13: 61,004,014 M76I probably benign Het
Cuedc1 C A 11: 88,170,129 S99R possibly damaging Het
Cyp4a14 T A 4: 115,492,150 I238F probably benign Het
Dnajb11 A T 16: 22,862,594 I41F probably damaging Het
Drd3 A G 16: 43,822,772 N425S probably damaging Het
Eci1 G C 17: 24,426,885 G25R probably damaging Het
Etl4 A T 2: 20,661,938 N52I probably benign Het
Fbxo34 T C 14: 47,531,267 Y746H probably damaging Het
Fndc1 T C 17: 7,772,790 I691M unknown Het
Fut8 A G 12: 77,393,733 T165A probably benign Het
Galr1 A T 18: 82,405,978 L58Q probably damaging Het
Gatsl3 A G 11: 4,219,015 K61E probably benign Het
Glt28d2 T C 3: 85,871,752 D138G probably benign Het
Gm11595 A T 11: 99,772,271 C194* probably null Het
Gm14403 T A 2: 177,509,628 N213K probably benign Het
Gm597 T A 1: 28,778,039 Y304F probably benign Het
Gm884 T A 11: 103,542,426 S3306C unknown Het
Gmpr T C 13: 45,546,043 V343A probably benign Het
Hacd1 T C 2: 14,035,867 N152D possibly damaging Het
Hcn1 A G 13: 117,873,986 S367G probably benign Het
Impg1 A G 9: 80,379,994 V390A probably benign Het
Itpr1 T C 6: 108,405,520 C1458R possibly damaging Het
Kif16b A T 2: 142,712,040 V946E probably benign Het
Krt71 T C 15: 101,736,553 E441G probably damaging Het
Lhcgr A G 17: 88,742,104 F665L probably benign Het
Lzic T A 4: 149,488,684 F98I probably damaging Het
Map3k8 A T 18: 4,339,546 V275D probably damaging Het
March8 C T 6: 116,401,444 T113I possibly damaging Het
Mmp15 A G 8: 95,372,103 probably null Het
Mpst A G 15: 78,410,269 D67G probably damaging Het
Nanog T C 6: 122,707,840 S20P probably benign Het
Ndufc2 T C 7: 97,406,895 S67P probably damaging Het
Nrg1 T C 8: 31,917,593 K204R possibly damaging Het
Nsf T A 11: 103,823,768 K728N probably damaging Het
Nutm2 C A 13: 50,474,865 P655H probably benign Het
Obscn G A 11: 59,052,571 R4251C probably benign Het
Olfr1189 A T 2: 88,592,713 Q303L probably benign Het
Olfr1225 T C 2: 89,171,408 probably benign Het
Olfr1234 T C 2: 89,362,721 Y236C probably damaging Het
Olfr683 T A 7: 105,143,958 T112S probably benign Het
Olfr749 C T 14: 50,736,742 C140Y probably benign Het
Olfr979 A T 9: 40,000,876 M117K probably damaging Het
Otog A T 7: 46,265,719 Q836L probably benign Het
Pcdhb11 T C 18: 37,422,966 F450L probably damaging Het
Pelp1 T C 11: 70,394,009 E1011G unknown Het
Pfkfb3 T G 2: 11,481,298 R459S probably benign Het
Pgm2 T C 4: 99,986,721 L567P probably damaging Het
Phf2 T A 13: 48,817,816 D460V unknown Het
Pou5f1 G A 17: 35,508,834 probably benign Het
Pou6f2 T C 13: 18,125,263 R604G Het
Pramel5 T A 4: 144,272,975 I181F probably benign Het
Ptprc T C 1: 138,080,889 R687G probably damaging Het
Ptprz1 T A 6: 23,007,293 H1618Q probably damaging Het
Qars G A 9: 108,514,383 D618N probably damaging Het
Ripply3 A G 16: 94,333,280 T68A probably benign Het
Rrad A G 8: 104,629,688 M160T probably benign Het
Rtn1 A G 12: 72,304,187 V416A probably damaging Het
Rttn A G 18: 89,017,210 N736S possibly damaging Het
Sash1 A T 10: 8,740,205 V631E probably damaging Het
Selenof T A 3: 144,577,609 F33L probably benign Het
Serpinb6b A T 13: 32,971,549 N82Y possibly damaging Het
Sez6 G A 11: 77,974,295 E623K possibly damaging Het
Shpk G T 11: 73,213,412 R129L probably damaging Het
Slc2a10 A C 2: 165,516,256 I434L probably damaging Het
Slc30a6 G T 17: 74,423,064 M316I probably benign Het
Slx4 A T 16: 3,986,105 H948Q probably benign Het
Sncaip A G 18: 52,906,654 E640G probably damaging Het
Sox7 G A 14: 63,948,060 A182T probably benign Het
Srcin1 A G 11: 97,551,822 I60T probably benign Het
Srm C T 4: 148,591,582 probably benign Het
Srrt A T 5: 137,298,427 M447K possibly damaging Het
Stam A T 2: 14,117,393 H101L probably damaging Het
Suz12 C T 11: 80,024,922 T407M possibly damaging Het
Tbc1d10b A G 7: 127,207,864 V167A probably benign Het
Trav16 T A 14: 53,743,453 V33E possibly damaging Het
Tshr C T 12: 91,537,635 P449L probably damaging Het
Ttc17 A G 2: 94,378,752 V119A probably damaging Het
Ttc19 A G 11: 62,313,171 I319M probably benign Het
Ttc6 A G 12: 57,617,513 M351V probably benign Het
Ttn G A 2: 76,884,553 R8026* probably null Het
Ttn A T 2: 76,919,866 V3613E probably benign Het
Twistnb G A 12: 33,429,724 G24R possibly damaging Het
Txndc16 T C 14: 45,163,010 I345V probably benign Het
Vmn1r73 T C 7: 11,756,480 F75S possibly damaging Het
Vmn2r54 A T 7: 12,629,826 M380K possibly damaging Het
Zfp820 T C 17: 21,819,126 Y407C probably damaging Het
Zic5 C T 14: 122,464,375 A315T unknown Het
Zmiz1 C A 14: 25,662,987 D1053E unknown Het
Other mutations in Ube3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ube3b APN 5 114415287 missense possibly damaging 0.93
IGL01154:Ube3b APN 5 114406252 missense probably null 0.86
IGL02632:Ube3b APN 5 114398841 missense probably benign
IGL02850:Ube3b APN 5 114406249 missense probably damaging 1.00
IGL02878:Ube3b APN 5 114404717 splice site probably null
IGL02881:Ube3b APN 5 114412884 missense possibly damaging 0.78
R0003:Ube3b UTSW 5 114398851 missense probably benign 0.17
R0071:Ube3b UTSW 5 114419497 missense probably damaging 1.00
R0071:Ube3b UTSW 5 114419497 missense probably damaging 1.00
R0076:Ube3b UTSW 5 114408217 critical splice donor site probably null
R0076:Ube3b UTSW 5 114408217 critical splice donor site probably null
R0111:Ube3b UTSW 5 114390376 splice site probably benign
R0309:Ube3b UTSW 5 114419469 splice site probably benign
R0718:Ube3b UTSW 5 114402555 nonsense probably null
R1344:Ube3b UTSW 5 114418575 missense probably damaging 1.00
R1350:Ube3b UTSW 5 114406137 splice site probably null
R1418:Ube3b UTSW 5 114418575 missense probably damaging 1.00
R1732:Ube3b UTSW 5 114387445 missense probably benign 0.01
R1764:Ube3b UTSW 5 114404617 missense possibly damaging 0.89
R1975:Ube3b UTSW 5 114399865 missense possibly damaging 0.80
R2014:Ube3b UTSW 5 114411149 missense probably damaging 1.00
R2015:Ube3b UTSW 5 114411149 missense probably damaging 1.00
R2041:Ube3b UTSW 5 114387233 missense probably damaging 0.99
R2074:Ube3b UTSW 5 114415255 missense probably benign 0.14
R2202:Ube3b UTSW 5 114389074 missense probably damaging 1.00
R2205:Ube3b UTSW 5 114389074 missense probably damaging 1.00
R3826:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3829:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3830:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3927:Ube3b UTSW 5 114415680 missense probably benign 0.03
R3974:Ube3b UTSW 5 114412430 missense probably benign 0.05
R4049:Ube3b UTSW 5 114412870 missense probably benign 0.09
R4096:Ube3b UTSW 5 114393086 missense possibly damaging 0.65
R4261:Ube3b UTSW 5 114398428 missense possibly damaging 0.80
R4415:Ube3b UTSW 5 114412444 missense probably damaging 1.00
R4688:Ube3b UTSW 5 114393078 missense probably benign 0.03
R4779:Ube3b UTSW 5 114404717 splice site probably null
R4824:Ube3b UTSW 5 114415726 splice site probably null
R4868:Ube3b UTSW 5 114398427 missense probably benign 0.00
R4953:Ube3b UTSW 5 114401410 missense probably benign 0.01
R5013:Ube3b UTSW 5 114407641 missense probably damaging 1.00
R5057:Ube3b UTSW 5 114406257 missense probably benign 0.01
R5117:Ube3b UTSW 5 114419631 missense probably damaging 0.96
R5131:Ube3b UTSW 5 114407546 missense probably damaging 1.00
R5498:Ube3b UTSW 5 114418574 missense probably damaging 1.00
R5564:Ube3b UTSW 5 114389075 missense probably damaging 1.00
R5572:Ube3b UTSW 5 114406179 missense probably damaging 0.99
R5580:Ube3b UTSW 5 114415323 missense probably benign
R5596:Ube3b UTSW 5 114406160 splice site probably null
R5843:Ube3b UTSW 5 114412299 missense probably damaging 1.00
R5910:Ube3b UTSW 5 114415309 missense possibly damaging 0.63
R6591:Ube3b UTSW 5 114408124 missense probably benign 0.00
R6691:Ube3b UTSW 5 114408124 missense probably benign 0.00
R7148:Ube3b UTSW 5 114406252 missense probably damaging 0.97
R7334:Ube3b UTSW 5 114415681 missense possibly damaging 0.64
R7438:Ube3b UTSW 5 114415284 missense possibly damaging 0.79
R7438:Ube3b UTSW 5 114418626 missense probably damaging 1.00
R7640:Ube3b UTSW 5 114415323 missense probably benign
R7825:Ube3b UTSW 5 114401312 missense probably damaging 1.00
R7958:Ube3b UTSW 5 114401423 missense probably benign 0.05
R8025:Ube3b UTSW 5 114408209 missense probably damaging 0.99
R8058:Ube3b UTSW 5 114406785 missense possibly damaging 0.58
R8087:Ube3b UTSW 5 114412489 critical splice donor site probably null
R8182:Ube3b UTSW 5 114392138 missense possibly damaging 0.77
R8322:Ube3b UTSW 5 114402686 missense probably benign 0.04
R8465:Ube3b UTSW 5 114390390 missense probably damaging 1.00
R8682:Ube3b UTSW 5 114412290 missense probably damaging 1.00
R8708:Ube3b UTSW 5 114393090 missense probably benign 0.34
R8758:Ube3b UTSW 5 114415200 critical splice acceptor site probably benign
R8784:Ube3b UTSW 5 114388739 missense probably damaging 1.00
R9058:Ube3b UTSW 5 114415239 missense probably benign 0.05
R9072:Ube3b UTSW 5 114404546 missense probably damaging 0.98
R9116:Ube3b UTSW 5 114404776 intron probably benign
R9537:Ube3b UTSW 5 114387184 missense probably damaging 1.00
R9596:Ube3b UTSW 5 114389110 missense probably damaging 1.00
R9710:Ube3b UTSW 5 114415309 missense probably benign 0.00
X0017:Ube3b UTSW 5 114415585 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GCTCATCTCTTAGCATGCTTGG -3'
(R):5'- AAATGGGCTGTCATCAGGATACC -3'

Sequencing Primer
(F):5'- CCTAGCCAGCTCATCCCAGTG -3'
(R):5'- GGATACCAGAGTCACTCTATGTCAG -3'
Posted On 2022-09-12