Incidental Mutation 'R0764:Cbl'
ID 72557
Institutional Source Beutler Lab
Gene Symbol Cbl
Ensembl Gene ENSMUSG00000034342
Gene Name Casitas B-lineage lymphoma
Synonyms Cbl-2, 4732447J05Rik, c-Cbl
MMRRC Submission 038944-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.503) question?
Stock # R0764 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 44054273-44145346 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 44075449 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 399 (C399S)
Ref Sequence ENSEMBL: ENSMUSP00000146244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037644] [ENSMUST00000205968] [ENSMUST00000206147] [ENSMUST00000206720]
AlphaFold P22682
Predicted Effect probably damaging
Transcript: ENSMUST00000037644
AA Change: C399S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041902
Gene: ENSMUSG00000034342
AA Change: C399S

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
Pfam:Cbl_N 49 173 9.4e-59 PFAM
Pfam:Cbl_N2 177 260 4.7e-44 PFAM
Pfam:Cbl_N3 262 347 7.2e-48 PFAM
RING 379 417 1.04e-7 SMART
low complexity region 454 463 N/A INTRINSIC
low complexity region 530 549 N/A INTRINSIC
UBA 864 901 3.17e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000205968
AA Change: C382S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206147
AA Change: C399S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000206540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206629
Predicted Effect probably damaging
Transcript: ENSMUST00000206720
AA Change: C399S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9744 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.1%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a proto-oncogene that encodes a RING finger E3 ubiquitin ligase. The encoded protein is one of the enzymes required for targeting substrates for degradation by the proteasome. This protein mediates the transfer of ubiquitin from ubiquitin conjugating enzymes (E2) to specific substrates. This protein also contains an N-terminal phosphotyrosine binding domain that allows it to interact with numerous tyrosine-phosphorylated substrates and target them for proteasome degradation. As such it functions as a negative regulator of many signal transduction pathways. This gene has been found to be mutated or translocated in many cancers including acute myeloid leukaemia, and expansion of CGG repeats in the 5' UTR has been associated with Jacobsen syndrome. Mutations in this gene are also the cause of Noonan syndrome-like disorder. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit increased thymic CD3 and CD4 expression and tyrosine-phosphorylation, lymphoid hyperplasia, and altered splenic hemopoiesis. Females show increased ductal density and branching in mammary fat pads. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 109,950,772 (GRCm39) Y898N probably damaging Het
Acp4 T C 7: 43,901,738 (GRCm39) probably benign Het
Adipor2 T C 6: 119,334,215 (GRCm39) I332V probably benign Het
Ago3 T A 4: 126,248,885 (GRCm39) K555N possibly damaging Het
Angpt4 A G 2: 151,753,204 (GRCm39) probably benign Het
Ano5 G T 7: 51,187,590 (GRCm39) probably benign Het
Ap3b1 C T 13: 94,616,387 (GRCm39) probably benign Het
Cdkl2 C A 5: 92,168,136 (GRCm39) V353L probably benign Het
Celsr3 A G 9: 108,705,017 (GRCm39) Y500C probably damaging Het
Cep162 A G 9: 87,083,798 (GRCm39) S1242P probably damaging Het
Crhr1 C T 11: 104,050,152 (GRCm39) R66W probably damaging Het
Ddx49 T C 8: 70,749,907 (GRCm39) E170G probably benign Het
Fam193a T C 5: 34,600,685 (GRCm39) F305L probably damaging Het
Fam76a C T 4: 132,638,010 (GRCm39) G198R probably damaging Het
Gm43302 T A 5: 105,428,355 (GRCm39) I130F probably benign Het
Hectd4 T A 5: 121,424,832 (GRCm39) I745N possibly damaging Het
Ina T A 19: 47,012,087 (GRCm39) *502K probably null Het
Kdm1b A T 13: 47,222,079 (GRCm39) D506V possibly damaging Het
Lrrk2 A G 15: 91,659,249 (GRCm39) probably null Het
Ly6g2 T A 15: 75,092,572 (GRCm39) F97Y probably benign Het
Naip5 A T 13: 100,353,613 (GRCm39) D1215E probably benign Het
Neb A G 2: 52,106,879 (GRCm39) probably benign Het
Nectin2 T A 7: 19,483,096 (GRCm39) probably null Het
Nup155 A T 15: 8,187,244 (GRCm39) H1391L probably damaging Het
Or2aj5 G T 16: 19,425,182 (GRCm39) P79T probably damaging Het
Or4a71 A G 2: 89,358,340 (GRCm39) V138A probably benign Het
Osbp A G 19: 11,961,520 (GRCm39) probably benign Het
Otog A G 7: 45,949,918 (GRCm39) D2460G probably benign Het
Pcgf1 T C 6: 83,056,150 (GRCm39) C2R probably damaging Het
Per2 C T 1: 91,357,142 (GRCm39) V674M probably damaging Het
Pias3 C T 3: 96,608,611 (GRCm39) P218S probably damaging Het
Plod3 C T 5: 137,018,437 (GRCm39) probably benign Het
Purb C T 11: 6,425,661 (GRCm39) V76M probably damaging Het
Ranbp1 C A 16: 18,058,022 (GRCm39) E181* probably null Het
Rit2 T C 18: 31,286,754 (GRCm39) probably benign Het
Rnf103 C A 6: 71,486,566 (GRCm39) T399K probably damaging Het
Slc22a13 T C 9: 119,037,746 (GRCm39) probably null Het
Slc35f4 T A 14: 49,543,796 (GRCm39) probably benign Het
Sucla2 C T 14: 73,798,074 (GRCm39) probably benign Het
Tnfrsf17 C T 16: 11,133,063 (GRCm39) T47M possibly damaging Het
Tram1 A G 1: 13,649,933 (GRCm39) I97T probably damaging Het
Ttc38 T C 15: 85,730,604 (GRCm39) probably benign Het
Zfp113 T A 5: 138,143,506 (GRCm39) Q248L probably damaging Het
Other mutations in Cbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Cbl APN 9 44,112,495 (GRCm39) missense probably damaging 1.00
IGL01369:Cbl APN 9 44,112,358 (GRCm39) nonsense probably null
IGL01434:Cbl APN 9 44,075,503 (GRCm39) missense probably damaging 0.99
IGL01866:Cbl APN 9 44,065,122 (GRCm39) nonsense probably null
IGL02326:Cbl APN 9 44,062,770 (GRCm39) missense possibly damaging 0.94
IGL02956:Cbl APN 9 44,080,331 (GRCm39) missense probably damaging 1.00
Bungalow UTSW 9 44,112,416 (GRCm39) missense probably damaging 1.00
Casita UTSW 9 44,075,462 (GRCm39) missense probably damaging 1.00
tiny_house UTSW 9 44,075,449 (GRCm39) missense probably damaging 1.00
R0068:Cbl UTSW 9 44,065,491 (GRCm39) missense probably damaging 0.98
R0390:Cbl UTSW 9 44,112,302 (GRCm39) missense probably damaging 1.00
R0655:Cbl UTSW 9 44,070,049 (GRCm39) missense probably damaging 1.00
R1466:Cbl UTSW 9 44,065,541 (GRCm39) missense probably benign 0.10
R1466:Cbl UTSW 9 44,065,541 (GRCm39) missense probably benign 0.10
R1616:Cbl UTSW 9 44,064,197 (GRCm39) missense probably damaging 0.99
R1736:Cbl UTSW 9 44,064,192 (GRCm39) missense possibly damaging 0.80
R1808:Cbl UTSW 9 44,075,526 (GRCm39) missense probably damaging 1.00
R1865:Cbl UTSW 9 44,075,462 (GRCm39) missense probably damaging 1.00
R3156:Cbl UTSW 9 44,070,147 (GRCm39) missense possibly damaging 0.74
R3431:Cbl UTSW 9 44,062,743 (GRCm39) makesense probably null
R4668:Cbl UTSW 9 44,065,145 (GRCm39) missense probably benign 0.00
R4700:Cbl UTSW 9 44,084,677 (GRCm39) missense probably damaging 1.00
R4866:Cbl UTSW 9 44,064,166 (GRCm39) missense probably benign 0.00
R4900:Cbl UTSW 9 44,064,166 (GRCm39) missense probably benign 0.00
R4995:Cbl UTSW 9 44,065,108 (GRCm39) missense possibly damaging 0.62
R5014:Cbl UTSW 9 44,065,696 (GRCm39) splice site probably null
R5324:Cbl UTSW 9 44,065,551 (GRCm39) missense probably damaging 0.97
R5353:Cbl UTSW 9 44,084,620 (GRCm39) missense probably damaging 1.00
R5382:Cbl UTSW 9 44,070,318 (GRCm39) missense probably benign
R5747:Cbl UTSW 9 44,112,416 (GRCm39) missense probably damaging 1.00
R5834:Cbl UTSW 9 44,145,076 (GRCm39) missense probably damaging 1.00
R6307:Cbl UTSW 9 44,069,809 (GRCm39) critical splice donor site probably null
R6755:Cbl UTSW 9 44,084,671 (GRCm39) missense probably damaging 0.98
R7393:Cbl UTSW 9 44,065,485 (GRCm39) critical splice donor site probably null
R7779:Cbl UTSW 9 44,070,393 (GRCm39) missense probably benign
R7789:Cbl UTSW 9 44,074,764 (GRCm39) missense probably damaging 1.00
R8094:Cbl UTSW 9 44,074,696 (GRCm39) missense probably benign 0.03
R8104:Cbl UTSW 9 44,069,836 (GRCm39) missense possibly damaging 0.93
R8146:Cbl UTSW 9 44,076,171 (GRCm39) missense probably damaging 1.00
R8340:Cbl UTSW 9 44,070,297 (GRCm39) missense possibly damaging 0.77
R8424:Cbl UTSW 9 44,064,151 (GRCm39) missense possibly damaging 0.51
R8920:Cbl UTSW 9 44,078,570 (GRCm39) missense probably damaging 0.99
R9185:Cbl UTSW 9 44,064,137 (GRCm39) missense probably damaging 1.00
X0057:Cbl UTSW 9 44,145,064 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ACAGCCCTGACCTTCTGATTCCT -3'
(R):5'- agcaccTATTGTGGCACTTGTATTTGA -3'

Sequencing Primer
(F):5'- aaaagggggctgaagagatg -3'
(R):5'- AAATTGACAGTTTTTGGTTCTCCTG -3'
Posted On 2013-09-30