Incidental Mutation 'R0764:Cbl'
ID72557
Institutional Source Beutler Lab
Gene Symbol Cbl
Ensembl Gene ENSMUSG00000034342
Gene NameCasitas B-lineage lymphoma
SynonymsCbl-2, c-Cbl
MMRRC Submission 038944-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.810) question?
Stock #R0764 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location44142976-44234049 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44164152 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 399 (C399S)
Ref Sequence ENSEMBL: ENSMUSP00000146244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037644] [ENSMUST00000205968] [ENSMUST00000206147] [ENSMUST00000206720]
Predicted Effect probably damaging
Transcript: ENSMUST00000037644
AA Change: C399S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041902
Gene: ENSMUSG00000034342
AA Change: C399S

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
Pfam:Cbl_N 49 173 9.4e-59 PFAM
Pfam:Cbl_N2 177 260 4.7e-44 PFAM
Pfam:Cbl_N3 262 347 7.2e-48 PFAM
RING 379 417 1.04e-7 SMART
low complexity region 454 463 N/A INTRINSIC
low complexity region 530 549 N/A INTRINSIC
UBA 864 901 3.17e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000205968
AA Change: C382S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206147
AA Change: C399S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000206540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206629
Predicted Effect probably damaging
Transcript: ENSMUST00000206720
AA Change: C399S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9744 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.1%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a proto-oncogene that encodes a RING finger E3 ubiquitin ligase. The encoded protein is one of the enzymes required for targeting substrates for degradation by the proteasome. This protein mediates the transfer of ubiquitin from ubiquitin conjugating enzymes (E2) to specific substrates. This protein also contains an N-terminal phosphotyrosine binding domain that allows it to interact with numerous tyrosine-phosphorylated substrates and target them for proteasome degradation. As such it functions as a negative regulator of many signal transduction pathways. This gene has been found to be mutated or translocated in many cancers including acute myeloid leukaemia, and expansion of CGG repeats in the 5' UTR has been associated with Jacobsen syndrome. Mutations in this gene are also the cause of Noonan syndrome-like disorder. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit increased thymic CD3 and CD4 expression and tyrosine-phosphorylation, lymphoid hyperplasia, and altered splenic hemopoiesis. Females show increased ductal density and branching in mammary fat pads. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,059,946 Y898N probably damaging Het
Acp4 T C 7: 44,252,314 probably benign Het
Adipor2 T C 6: 119,357,254 I332V probably benign Het
Ago3 T A 4: 126,355,092 K555N possibly damaging Het
Angpt4 A G 2: 151,911,284 probably benign Het
Ano5 G T 7: 51,537,842 probably benign Het
Ap3b1 C T 13: 94,479,879 probably benign Het
BC025446 T A 15: 75,220,723 F97Y probably benign Het
Cdkl2 C A 5: 92,020,277 V353L probably benign Het
Celsr3 A G 9: 108,827,818 Y500C probably damaging Het
Cep162 A G 9: 87,201,745 S1242P probably damaging Het
Crhr1 C T 11: 104,159,326 R66W probably damaging Het
Ddx49 T C 8: 70,297,257 E170G probably benign Het
Fam193a T C 5: 34,443,341 F305L probably damaging Het
Fam76a C T 4: 132,910,699 G198R probably damaging Het
Gm43302 T A 5: 105,280,489 I130F probably benign Het
Hectd4 T A 5: 121,286,769 I745N possibly damaging Het
Ina T A 19: 47,023,648 *502K probably null Het
Kdm1b A T 13: 47,068,603 D506V possibly damaging Het
Lrrk2 A G 15: 91,775,046 probably null Het
Naip5 A T 13: 100,217,105 D1215E probably benign Het
Neb A G 2: 52,216,867 probably benign Het
Nectin2 T A 7: 19,749,171 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1243 A G 2: 89,527,996 V138A probably benign Het
Olfr170 G T 16: 19,606,432 P79T probably damaging Het
Osbp A G 19: 11,984,156 probably benign Het
Otog A G 7: 46,300,494 D2460G probably benign Het
Pcgf1 T C 6: 83,079,169 C2R probably damaging Het
Per2 C T 1: 91,429,420 V674M probably damaging Het
Pias3 C T 3: 96,701,295 P218S probably damaging Het
Plod3 C T 5: 136,989,583 probably benign Het
Purb C T 11: 6,475,661 V76M probably damaging Het
Ranbp1 C A 16: 18,240,158 E181* probably null Het
Rit2 T C 18: 31,153,701 probably benign Het
Rnf103 C A 6: 71,509,582 T399K probably damaging Het
Slc22a13 T C 9: 119,208,680 probably null Het
Slc35f4 T A 14: 49,306,339 probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tnfrsf17 C T 16: 11,315,199 T47M possibly damaging Het
Tram1 A G 1: 13,579,709 I97T probably damaging Het
Ttc38 T C 15: 85,846,403 probably benign Het
Zfp113 T A 5: 138,145,244 Q248L probably damaging Het
Other mutations in Cbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Cbl APN 9 44201198 missense probably damaging 1.00
IGL01369:Cbl APN 9 44201061 nonsense probably null
IGL01434:Cbl APN 9 44164206 missense probably damaging 0.99
IGL01866:Cbl APN 9 44153825 nonsense probably null
IGL02326:Cbl APN 9 44151473 missense possibly damaging 0.94
IGL02956:Cbl APN 9 44169034 missense probably damaging 1.00
Bungalow UTSW 9 44201119 missense probably damaging 1.00
Casita UTSW 9 44164165 missense probably damaging 1.00
tiny_house UTSW 9 44164152 missense probably damaging 1.00
R0068:Cbl UTSW 9 44154194 missense probably damaging 0.98
R0390:Cbl UTSW 9 44201005 missense probably damaging 1.00
R0655:Cbl UTSW 9 44158752 missense probably damaging 1.00
R1466:Cbl UTSW 9 44154244 missense probably benign 0.10
R1466:Cbl UTSW 9 44154244 missense probably benign 0.10
R1616:Cbl UTSW 9 44152900 missense probably damaging 0.99
R1736:Cbl UTSW 9 44152895 missense possibly damaging 0.80
R1808:Cbl UTSW 9 44164229 missense probably damaging 1.00
R1865:Cbl UTSW 9 44164165 missense probably damaging 1.00
R3156:Cbl UTSW 9 44158850 missense possibly damaging 0.74
R3431:Cbl UTSW 9 44151446 makesense probably null
R4668:Cbl UTSW 9 44153848 missense probably benign 0.00
R4700:Cbl UTSW 9 44173380 missense probably damaging 1.00
R4866:Cbl UTSW 9 44152869 missense probably benign 0.00
R4900:Cbl UTSW 9 44152869 missense probably benign 0.00
R4995:Cbl UTSW 9 44153811 missense possibly damaging 0.62
R5014:Cbl UTSW 9 44154399 intron probably null
R5324:Cbl UTSW 9 44154254 missense probably damaging 0.97
R5353:Cbl UTSW 9 44173323 missense probably damaging 1.00
R5382:Cbl UTSW 9 44159021 missense probably benign
R5747:Cbl UTSW 9 44201119 missense probably damaging 1.00
R5834:Cbl UTSW 9 44233779 missense probably damaging 1.00
R6307:Cbl UTSW 9 44158512 critical splice donor site probably null
R6755:Cbl UTSW 9 44173374 missense probably damaging 0.98
R7393:Cbl UTSW 9 44154188 critical splice donor site probably null
R7779:Cbl UTSW 9 44159096 missense probably benign
R7789:Cbl UTSW 9 44163467 missense probably damaging 1.00
R8094:Cbl UTSW 9 44163399 missense probably benign 0.03
R8104:Cbl UTSW 9 44158539 missense possibly damaging 0.93
R8146:Cbl UTSW 9 44164874 missense probably damaging 1.00
X0057:Cbl UTSW 9 44233767 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ACAGCCCTGACCTTCTGATTCCT -3'
(R):5'- agcaccTATTGTGGCACTTGTATTTGA -3'

Sequencing Primer
(F):5'- aaaagggggctgaagagatg -3'
(R):5'- AAATTGACAGTTTTTGGTTCTCCTG -3'
Posted On2013-09-30