Incidental Mutation 'R0764:Cep162'
ID72558
Institutional Source Beutler Lab
Gene Symbol Cep162
Ensembl Gene ENSMUSG00000056919
Gene Namecentrosomal protein 162
Synonyms4922501C03Rik
MMRRC Submission 038944-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R0764 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location87189577-87255536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87201745 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1242 (S1242P)
Ref Sequence ENSEMBL: ENSMUSP00000091319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093802]
Predicted Effect probably damaging
Transcript: ENSMUST00000093802
AA Change: S1242P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091319
Gene: ENSMUSG00000056919
AA Change: S1242P

DomainStartEndE-ValueType
low complexity region 198 208 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
coiled coil region 630 674 N/A INTRINSIC
coiled coil region 695 899 N/A INTRINSIC
coiled coil region 953 1124 N/A INTRINSIC
coiled coil region 1235 1386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157106
Meta Mutation Damage Score 0.1203 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.1%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,059,946 Y898N probably damaging Het
Acp4 T C 7: 44,252,314 probably benign Het
Adipor2 T C 6: 119,357,254 I332V probably benign Het
Ago3 T A 4: 126,355,092 K555N possibly damaging Het
Angpt4 A G 2: 151,911,284 probably benign Het
Ano5 G T 7: 51,537,842 probably benign Het
Ap3b1 C T 13: 94,479,879 probably benign Het
BC025446 T A 15: 75,220,723 F97Y probably benign Het
Cbl A T 9: 44,164,152 C399S probably damaging Het
Cdkl2 C A 5: 92,020,277 V353L probably benign Het
Celsr3 A G 9: 108,827,818 Y500C probably damaging Het
Crhr1 C T 11: 104,159,326 R66W probably damaging Het
Ddx49 T C 8: 70,297,257 E170G probably benign Het
Fam193a T C 5: 34,443,341 F305L probably damaging Het
Fam76a C T 4: 132,910,699 G198R probably damaging Het
Gm43302 T A 5: 105,280,489 I130F probably benign Het
Hectd4 T A 5: 121,286,769 I745N possibly damaging Het
Ina T A 19: 47,023,648 *502K probably null Het
Kdm1b A T 13: 47,068,603 D506V possibly damaging Het
Lrrk2 A G 15: 91,775,046 probably null Het
Naip5 A T 13: 100,217,105 D1215E probably benign Het
Neb A G 2: 52,216,867 probably benign Het
Nectin2 T A 7: 19,749,171 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1243 A G 2: 89,527,996 V138A probably benign Het
Olfr170 G T 16: 19,606,432 P79T probably damaging Het
Osbp A G 19: 11,984,156 probably benign Het
Otog A G 7: 46,300,494 D2460G probably benign Het
Pcgf1 T C 6: 83,079,169 C2R probably damaging Het
Per2 C T 1: 91,429,420 V674M probably damaging Het
Pias3 C T 3: 96,701,295 P218S probably damaging Het
Plod3 C T 5: 136,989,583 probably benign Het
Purb C T 11: 6,475,661 V76M probably damaging Het
Ranbp1 C A 16: 18,240,158 E181* probably null Het
Rit2 T C 18: 31,153,701 probably benign Het
Rnf103 C A 6: 71,509,582 T399K probably damaging Het
Slc22a13 T C 9: 119,208,680 probably null Het
Slc35f4 T A 14: 49,306,339 probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tnfrsf17 C T 16: 11,315,199 T47M possibly damaging Het
Tram1 A G 1: 13,579,709 I97T probably damaging Het
Ttc38 T C 15: 85,846,403 probably benign Het
Zfp113 T A 5: 138,145,244 Q248L probably damaging Het
Other mutations in Cep162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Cep162 APN 9 87227167 missense probably benign 0.24
IGL00584:Cep162 APN 9 87221090 splice site probably benign
IGL01387:Cep162 APN 9 87211811 missense probably benign 0.08
IGL01862:Cep162 APN 9 87253933 missense possibly damaging 0.90
IGL02304:Cep162 APN 9 87227147 splice site probably benign
IGL02558:Cep162 APN 9 87225733 missense probably benign 0.04
IGL02558:Cep162 APN 9 87225726 missense probably benign
IGL02602:Cep162 APN 9 87246153 missense probably benign 0.19
IGL02636:Cep162 APN 9 87248379 missense possibly damaging 0.90
IGL02680:Cep162 APN 9 87246744 missense possibly damaging 0.64
IGL03195:Cep162 APN 9 87225786 missense probably benign 0.00
PIT4378001:Cep162 UTSW 9 87217145 missense probably benign 0.01
PIT4431001:Cep162 UTSW 9 87244345 missense probably benign 0.00
PIT4434001:Cep162 UTSW 9 87193648 missense probably damaging 1.00
R0060:Cep162 UTSW 9 87237825 splice site probably benign
R0218:Cep162 UTSW 9 87211809 missense possibly damaging 0.73
R0366:Cep162 UTSW 9 87220484 missense probably damaging 0.96
R0468:Cep162 UTSW 9 87193697 missense probably damaging 1.00
R1386:Cep162 UTSW 9 87221202 missense probably benign
R1614:Cep162 UTSW 9 87212932 missense probably damaging 1.00
R1633:Cep162 UTSW 9 87203683 missense probably benign 0.23
R1831:Cep162 UTSW 9 87206932 missense probably damaging 1.00
R1847:Cep162 UTSW 9 87204080 missense probably benign 0.06
R1941:Cep162 UTSW 9 87199995 missense probably benign 0.14
R2228:Cep162 UTSW 9 87244331 missense probably benign 0.05
R2256:Cep162 UTSW 9 87206914 missense probably damaging 1.00
R2257:Cep162 UTSW 9 87206914 missense probably damaging 1.00
R2936:Cep162 UTSW 9 87227414 missense probably benign
R3005:Cep162 UTSW 9 87232060 missense probably benign 0.00
R3508:Cep162 UTSW 9 87231977 critical splice donor site probably null
R3689:Cep162 UTSW 9 87225694 nonsense probably null
R3743:Cep162 UTSW 9 87217177 splice site probably benign
R4118:Cep162 UTSW 9 87204176 missense probably benign 0.30
R4380:Cep162 UTSW 9 87200003 missense probably damaging 0.99
R4450:Cep162 UTSW 9 87225808 missense probably damaging 1.00
R4540:Cep162 UTSW 9 87212939 missense probably damaging 1.00
R4598:Cep162 UTSW 9 87203795 missense possibly damaging 0.95
R4700:Cep162 UTSW 9 87206862 missense probably damaging 1.00
R4941:Cep162 UTSW 9 87225969 intron probably benign
R5356:Cep162 UTSW 9 87206895 missense probably damaging 1.00
R5468:Cep162 UTSW 9 87227237 missense probably benign 0.00
R5579:Cep162 UTSW 9 87203671 missense probably benign 0.26
R5859:Cep162 UTSW 9 87204092 missense probably damaging 1.00
R6114:Cep162 UTSW 9 87203710 missense probably benign
R6143:Cep162 UTSW 9 87212851 critical splice donor site probably null
R6422:Cep162 UTSW 9 87232016 missense possibly damaging 0.92
R6517:Cep162 UTSW 9 87222174 missense probably damaging 0.99
R6576:Cep162 UTSW 9 87217145 missense probably benign 0.01
R6782:Cep162 UTSW 9 87211684 missense probably benign 0.07
R6867:Cep162 UTSW 9 87217081 nonsense probably null
R7293:Cep162 UTSW 9 87203783 missense probably benign 0.01
R7355:Cep162 UTSW 9 87253955 nonsense probably null
R7391:Cep162 UTSW 9 87248494 nonsense probably null
R7426:Cep162 UTSW 9 87192766 missense probably damaging 1.00
R7593:Cep162 UTSW 9 87204197 missense probably benign 0.40
R7710:Cep162 UTSW 9 87232119 missense probably damaging 1.00
R7841:Cep162 UTSW 9 87244316 missense probably benign 0.00
R7924:Cep162 UTSW 9 87244316 missense probably benign 0.00
X0063:Cep162 UTSW 9 87222042 critical splice donor site probably null
Z1177:Cep162 UTSW 9 87199980 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACCGCACACTAGAGGAAGATCTGAG -3'
(R):5'- GCGTTACATGAGTGAGAGCCACTG -3'

Sequencing Primer
(F):5'- TATCGGGGCCAGTCTGTATAAAC -3'
(R):5'- AGAGCCACTGCACATGCTG -3'
Posted On2013-09-30