Incidental Mutation 'R0764:Slc22a13'
ID72560
Institutional Source Beutler Lab
Gene Symbol Slc22a13
Ensembl Gene ENSMUSG00000074028
Gene Namesolute carrier family 22 (organic cation transporter), member 13
SynonymsOCTL1, ORCTL3, OCTL3
MMRRC Submission 038944-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R0764 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119192974-119209098 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 119208680 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000081855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084797] [ENSMUST00000170400]
Predicted Effect probably null
Transcript: ENSMUST00000084797
SMART Domains Protein: ENSMUSP00000081855
Gene: ENSMUSG00000074028

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Sugar_tr 104 514 2.2e-41 PFAM
Pfam:MFS_1 133 468 2.6e-26 PFAM
Pfam:MFS_1 355 537 2.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170400
SMART Domains Protein: ENSMUSP00000131982
Gene: ENSMUSG00000070280

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Sugar_tr 150 555 1.2e-28 PFAM
Pfam:MFS_1 178 514 7.6e-28 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.1%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the organic-cation transporter family. It is located in a gene cluster with another member of the family, organic cation transporter like 4. The encoded protein is a transmembrane protein involved in the transport of small molecules. This protein can function to mediate urate uptake and is a high affinity nicotinate exchanger in the kidneys and the intestine. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,059,946 Y898N probably damaging Het
Acp4 T C 7: 44,252,314 probably benign Het
Adipor2 T C 6: 119,357,254 I332V probably benign Het
Ago3 T A 4: 126,355,092 K555N possibly damaging Het
Angpt4 A G 2: 151,911,284 probably benign Het
Ano5 G T 7: 51,537,842 probably benign Het
Ap3b1 C T 13: 94,479,879 probably benign Het
BC025446 T A 15: 75,220,723 F97Y probably benign Het
Cbl A T 9: 44,164,152 C399S probably damaging Het
Cdkl2 C A 5: 92,020,277 V353L probably benign Het
Celsr3 A G 9: 108,827,818 Y500C probably damaging Het
Cep162 A G 9: 87,201,745 S1242P probably damaging Het
Crhr1 C T 11: 104,159,326 R66W probably damaging Het
Ddx49 T C 8: 70,297,257 E170G probably benign Het
Fam193a T C 5: 34,443,341 F305L probably damaging Het
Fam76a C T 4: 132,910,699 G198R probably damaging Het
Gm43302 T A 5: 105,280,489 I130F probably benign Het
Hectd4 T A 5: 121,286,769 I745N possibly damaging Het
Ina T A 19: 47,023,648 *502K probably null Het
Kdm1b A T 13: 47,068,603 D506V possibly damaging Het
Lrrk2 A G 15: 91,775,046 probably null Het
Naip5 A T 13: 100,217,105 D1215E probably benign Het
Neb A G 2: 52,216,867 probably benign Het
Nectin2 T A 7: 19,749,171 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1243 A G 2: 89,527,996 V138A probably benign Het
Olfr170 G T 16: 19,606,432 P79T probably damaging Het
Osbp A G 19: 11,984,156 probably benign Het
Otog A G 7: 46,300,494 D2460G probably benign Het
Pcgf1 T C 6: 83,079,169 C2R probably damaging Het
Per2 C T 1: 91,429,420 V674M probably damaging Het
Pias3 C T 3: 96,701,295 P218S probably damaging Het
Plod3 C T 5: 136,989,583 probably benign Het
Purb C T 11: 6,475,661 V76M probably damaging Het
Ranbp1 C A 16: 18,240,158 E181* probably null Het
Rit2 T C 18: 31,153,701 probably benign Het
Rnf103 C A 6: 71,509,582 T399K probably damaging Het
Slc35f4 T A 14: 49,306,339 probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tnfrsf17 C T 16: 11,315,199 T47M possibly damaging Het
Tram1 A G 1: 13,579,709 I97T probably damaging Het
Ttc38 T C 15: 85,846,403 probably benign Het
Zfp113 T A 5: 138,145,244 Q248L probably damaging Het
Other mutations in Slc22a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02828:Slc22a13 APN 9 119195707 missense probably benign 0.25
IGL02871:Slc22a13 APN 9 119196011 missense probably benign 0.01
R1469:Slc22a13 UTSW 9 119193295 missense possibly damaging 0.67
R1469:Slc22a13 UTSW 9 119193295 missense possibly damaging 0.67
R1545:Slc22a13 UTSW 9 119209047 missense probably benign 0.00
R2154:Slc22a13 UTSW 9 119208687 missense probably benign 0.00
R2321:Slc22a13 UTSW 9 119195628 missense possibly damaging 0.61
R3808:Slc22a13 UTSW 9 119196077 missense probably benign
R3840:Slc22a13 UTSW 9 119208789 missense probably benign 0.18
R4736:Slc22a13 UTSW 9 119193632 missense probably damaging 1.00
R6286:Slc22a13 UTSW 9 119208712 nonsense probably null
R6899:Slc22a13 UTSW 9 119196407 missense probably damaging 1.00
R7579:Slc22a13 UTSW 9 119195160 missense possibly damaging 0.62
R8755:Slc22a13 UTSW 9 119209060 start codon destroyed probably damaging 0.98
Z1177:Slc22a13 UTSW 9 119193304 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGGCCCCTTCTTTAATACACCAG -3'
(R):5'- ACACTTTCAACCTAAGTGCCGCTG -3'

Sequencing Primer
(F):5'- CCTTCTTTAATACACCAGAGGTGG -3'
(R):5'- TAAGTGCCGCTGAGCAG -3'
Posted On2013-09-30