Incidental Mutation 'R9632:Bptf'
ID 725601
Institutional Source Beutler Lab
Gene Symbol Bptf
Ensembl Gene ENSMUSG00000040481
Gene Name bromodomain PHD finger transcription factor
Synonyms 9430093H17Rik, Falz
Accession Numbers

Genbank: NM_176850; MGI: 2444008

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9632 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 107033081-107132127 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 107061719 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 2166 (T2166S)
Ref Sequence ENSEMBL: ENSMUSP00000102374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057892] [ENSMUST00000106762] [ENSMUST00000106763] [ENSMUST00000149486]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000057892
AA Change: T2051S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052303
Gene: ENSMUSG00000040481
AA Change: T2051S

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.7e-8 PFAM
PHD 404 447 2.23e-11 SMART
coiled coil region 864 894 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 987 998 N/A INTRINSIC
low complexity region 1062 1072 N/A INTRINSIC
low complexity region 1086 1098 N/A INTRINSIC
low complexity region 1225 1238 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1491 1503 N/A INTRINSIC
low complexity region 1594 1613 N/A INTRINSIC
low complexity region 1636 1645 N/A INTRINSIC
low complexity region 1665 1683 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
coiled coil region 1908 1936 N/A INTRINSIC
low complexity region 1941 1957 N/A INTRINSIC
low complexity region 2051 2061 N/A INTRINSIC
low complexity region 2092 2107 N/A INTRINSIC
low complexity region 2115 2128 N/A INTRINSIC
low complexity region 2175 2197 N/A INTRINSIC
low complexity region 2227 2252 N/A INTRINSIC
low complexity region 2275 2312 N/A INTRINSIC
low complexity region 2336 2355 N/A INTRINSIC
low complexity region 2361 2378 N/A INTRINSIC
low complexity region 2390 2420 N/A INTRINSIC
low complexity region 2430 2463 N/A INTRINSIC
coiled coil region 2489 2527 N/A INTRINSIC
coiled coil region 2576 2604 N/A INTRINSIC
low complexity region 2663 2700 N/A INTRINSIC
low complexity region 2713 2736 N/A INTRINSIC
PHD 2744 2791 5.32e-9 SMART
BROMO 2800 2908 5.5e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106762
AA Change: T2103S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102373
Gene: ENSMUSG00000040481
AA Change: T2103S

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.7e-8 PFAM
PHD 404 447 2.23e-11 SMART
internal_repeat_1 589 642 6.48e-5 PROSPERO
low complexity region 644 654 N/A INTRINSIC
low complexity region 662 679 N/A INTRINSIC
coiled coil region 926 956 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1039 1050 N/A INTRINSIC
low complexity region 1114 1124 N/A INTRINSIC
low complexity region 1138 1150 N/A INTRINSIC
low complexity region 1277 1290 N/A INTRINSIC
low complexity region 1303 1317 N/A INTRINSIC
internal_repeat_1 1387 1440 6.48e-5 PROSPERO
low complexity region 1543 1555 N/A INTRINSIC
low complexity region 1646 1665 N/A INTRINSIC
low complexity region 1688 1697 N/A INTRINSIC
low complexity region 1717 1735 N/A INTRINSIC
low complexity region 1870 1886 N/A INTRINSIC
coiled coil region 1960 1988 N/A INTRINSIC
low complexity region 1993 2009 N/A INTRINSIC
low complexity region 2103 2113 N/A INTRINSIC
low complexity region 2144 2159 N/A INTRINSIC
low complexity region 2167 2180 N/A INTRINSIC
low complexity region 2227 2249 N/A INTRINSIC
low complexity region 2279 2304 N/A INTRINSIC
low complexity region 2327 2364 N/A INTRINSIC
low complexity region 2388 2407 N/A INTRINSIC
low complexity region 2413 2430 N/A INTRINSIC
low complexity region 2442 2472 N/A INTRINSIC
low complexity region 2482 2515 N/A INTRINSIC
coiled coil region 2541 2579 N/A INTRINSIC
coiled coil region 2628 2656 N/A INTRINSIC
low complexity region 2715 2752 N/A INTRINSIC
low complexity region 2765 2788 N/A INTRINSIC
PHD 2796 2843 5.32e-9 SMART
BROMO 2852 2960 5.5e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106763
AA Change: T2166S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102374
Gene: ENSMUSG00000040481
AA Change: T2166S

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.9e-8 PFAM
PHD 404 447 2.23e-11 SMART
low complexity region 624 639 N/A INTRINSIC
low complexity region 707 717 N/A INTRINSIC
low complexity region 725 742 N/A INTRINSIC
coiled coil region 989 1019 N/A INTRINSIC
low complexity region 1076 1088 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1177 1187 N/A INTRINSIC
low complexity region 1201 1213 N/A INTRINSIC
low complexity region 1340 1353 N/A INTRINSIC
low complexity region 1366 1380 N/A INTRINSIC
low complexity region 1606 1618 N/A INTRINSIC
low complexity region 1709 1728 N/A INTRINSIC
low complexity region 1751 1760 N/A INTRINSIC
low complexity region 1780 1798 N/A INTRINSIC
low complexity region 1933 1949 N/A INTRINSIC
coiled coil region 2023 2051 N/A INTRINSIC
low complexity region 2056 2072 N/A INTRINSIC
low complexity region 2166 2176 N/A INTRINSIC
low complexity region 2207 2222 N/A INTRINSIC
low complexity region 2230 2243 N/A INTRINSIC
low complexity region 2290 2312 N/A INTRINSIC
low complexity region 2342 2367 N/A INTRINSIC
low complexity region 2390 2427 N/A INTRINSIC
low complexity region 2451 2470 N/A INTRINSIC
low complexity region 2476 2493 N/A INTRINSIC
low complexity region 2505 2535 N/A INTRINSIC
low complexity region 2545 2578 N/A INTRINSIC
coiled coil region 2604 2642 N/A INTRINSIC
coiled coil region 2691 2719 N/A INTRINSIC
low complexity region 2778 2815 N/A INTRINSIC
low complexity region 2828 2851 N/A INTRINSIC
PHD 2859 2906 5.32e-9 SMART
BROMO 2915 3023 5.5e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000149486
AA Change: T267S

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122575
Gene: ENSMUSG00000040481
AA Change: T267S

DomainStartEndE-ValueType
coiled coil region 70 98 N/A INTRINSIC
low complexity region 103 119 N/A INTRINSIC
low complexity region 171 188 N/A INTRINSIC
low complexity region 267 277 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by the reactivity of its encoded protein to a monoclonal antibody prepared against brain homogenates from patients with Alzheimer's disease. Analysis of the original protein (fetal Alz-50 reactive clone 1, or FAC1), identified as an 810 aa protein containing a DNA-binding domain and a zinc finger motif, suggested it might play a role in the regulation of transcription. High levels of FAC1 were detected in fetal brain and in patients with neurodegenerative diseases. The protein encoded by this gene is actually much larger than originally thought, and it also contains a C-terminal bromodomain characteristic of proteins that regulate transcription during proliferation. The encoded protein is highly similar to the largest subunit of the Drosophila NURF (nucleosome remodeling factor) complex. In Drosophila, the NURF complex, which catalyzes nucleosome sliding on DNA and interacts with sequence-specific transcription factors, is necessary for the chromatin remodeling required for transcription. Two alternative transcripts encoding different isoforms have been described completely. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with embryonic growth arrest around early gastrulation and a greatly reduced ectoplacental cone. [provided by MGI curators]
Allele List at MGI

All alleles(58) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(56)

Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,142,301 I554V probably benign Het
Acly A G 11: 100,498,246 I570T probably damaging Het
Adamtsl4 G A 3: 95,681,780 T447I probably damaging Het
Ahcyl1 T A 3: 107,671,178 I248F possibly damaging Het
Arhgef2 T C 3: 88,621,269 I4T probably benign Het
Bin2 T C 15: 100,652,034 D176G possibly damaging Het
Cachd1 T A 4: 100,974,895 N751K probably benign Het
CN725425 A T 15: 91,242,648 T214S possibly damaging Het
Crtam A T 9: 40,984,375 D218E probably benign Het
Ctsj C T 13: 61,004,014 M76I probably benign Het
Cuedc1 C A 11: 88,170,129 S99R possibly damaging Het
Cyp4a14 T A 4: 115,492,150 I238F probably benign Het
Dnajb11 A T 16: 22,862,594 I41F probably damaging Het
Drd3 A G 16: 43,822,772 N425S probably damaging Het
Eci1 G C 17: 24,426,885 G25R probably damaging Het
Etl4 A T 2: 20,661,938 N52I probably benign Het
Fbxo34 T C 14: 47,531,267 Y746H probably damaging Het
Fndc1 T C 17: 7,772,790 I691M unknown Het
Fut8 A G 12: 77,393,733 T165A probably benign Het
Galr1 A T 18: 82,405,978 L58Q probably damaging Het
Gatsl3 A G 11: 4,219,015 K61E probably benign Het
Glt28d2 T C 3: 85,871,752 D138G probably benign Het
Gm11595 A T 11: 99,772,271 C194* probably null Het
Gm14403 T A 2: 177,509,628 N213K probably benign Het
Gm597 T A 1: 28,778,039 Y304F probably benign Het
Gm884 T A 11: 103,542,426 S3306C unknown Het
Gmpr T C 13: 45,546,043 V343A probably benign Het
Hacd1 T C 2: 14,035,867 N152D possibly damaging Het
Hcn1 A G 13: 117,873,986 S367G probably benign Het
Impg1 A G 9: 80,379,994 V390A probably benign Het
Itpr1 T C 6: 108,405,520 C1458R possibly damaging Het
Kif16b A T 2: 142,712,040 V946E probably benign Het
Krt71 T C 15: 101,736,553 E441G probably damaging Het
Lhcgr A G 17: 88,742,104 F665L probably benign Het
Lzic T A 4: 149,488,684 F98I probably damaging Het
Map3k8 A T 18: 4,339,546 V275D probably damaging Het
March8 C T 6: 116,401,444 T113I possibly damaging Het
Mmp15 A G 8: 95,372,103 probably null Het
Mpst A G 15: 78,410,269 D67G probably damaging Het
Nanog T C 6: 122,707,840 S20P probably benign Het
Ndufc2 T C 7: 97,406,895 S67P probably damaging Het
Nrg1 T C 8: 31,917,593 K204R possibly damaging Het
Nsf T A 11: 103,823,768 K728N probably damaging Het
Nutm2 C A 13: 50,474,865 P655H probably benign Het
Obscn G A 11: 59,052,571 R4251C probably benign Het
Olfr1189 A T 2: 88,592,713 Q303L probably benign Het
Olfr1225 T C 2: 89,171,408 probably benign Het
Olfr1234 T C 2: 89,362,721 Y236C probably damaging Het
Olfr683 T A 7: 105,143,958 T112S probably benign Het
Olfr749 C T 14: 50,736,742 C140Y probably benign Het
Olfr979 A T 9: 40,000,876 M117K probably damaging Het
Otog A T 7: 46,265,719 Q836L probably benign Het
Pcdhb11 T C 18: 37,422,966 F450L probably damaging Het
Pelp1 T C 11: 70,394,009 E1011G unknown Het
Pfkfb3 T G 2: 11,481,298 R459S probably benign Het
Pgm2 T C 4: 99,986,721 L567P probably damaging Het
Phf2 T A 13: 48,817,816 D460V unknown Het
Pou5f1 G A 17: 35,508,834 probably benign Het
Pou6f2 T C 13: 18,125,263 R604G Het
Pramel5 T A 4: 144,272,975 I181F probably benign Het
Ptprc T C 1: 138,080,889 R687G probably damaging Het
Ptprz1 T A 6: 23,007,293 H1618Q probably damaging Het
Qars G A 9: 108,514,383 D618N probably damaging Het
Ripply3 A G 16: 94,333,280 T68A probably benign Het
Rrad A G 8: 104,629,688 M160T probably benign Het
Rtn1 A G 12: 72,304,187 V416A probably damaging Het
Rttn A G 18: 89,017,210 N736S possibly damaging Het
Sash1 A T 10: 8,740,205 V631E probably damaging Het
Selenof T A 3: 144,577,609 F33L probably benign Het
Serpinb6b A T 13: 32,971,549 N82Y possibly damaging Het
Sez6 G A 11: 77,974,295 E623K possibly damaging Het
Shpk G T 11: 73,213,412 R129L probably damaging Het
Slc2a10 A C 2: 165,516,256 I434L probably damaging Het
Slc30a6 G T 17: 74,423,064 M316I probably benign Het
Slx4 A T 16: 3,986,105 H948Q probably benign Het
Sncaip A G 18: 52,906,654 E640G probably damaging Het
Sox7 G A 14: 63,948,060 A182T probably benign Het
Srcin1 A G 11: 97,551,822 I60T probably benign Het
Srm C T 4: 148,591,582 probably benign Het
Srrt A T 5: 137,298,427 M447K possibly damaging Het
Stam A T 2: 14,117,393 H101L probably damaging Het
Suz12 C T 11: 80,024,922 T407M possibly damaging Het
Tbc1d10b A G 7: 127,207,864 V167A probably benign Het
Trav16 T A 14: 53,743,453 V33E possibly damaging Het
Tshr C T 12: 91,537,635 P449L probably damaging Het
Ttc17 A G 2: 94,378,752 V119A probably damaging Het
Ttc19 A G 11: 62,313,171 I319M probably benign Het
Ttc6 A G 12: 57,617,513 M351V probably benign Het
Ttn G A 2: 76,884,553 R8026* probably null Het
Ttn A T 2: 76,919,866 V3613E probably benign Het
Twistnb G A 12: 33,429,724 G24R possibly damaging Het
Txndc16 T C 14: 45,163,010 I345V probably benign Het
Ube3b T C 5: 114,415,309 I914T probably benign Het
Vmn1r73 T C 7: 11,756,480 F75S possibly damaging Het
Vmn2r54 A T 7: 12,629,826 M380K possibly damaging Het
Zfp820 T C 17: 21,819,126 Y407C probably damaging Het
Zic5 C T 14: 122,464,375 A315T unknown Het
Zmiz1 C A 14: 25,662,987 D1053E unknown Het
Other mutations in Bptf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Bptf APN 11 107055279 missense possibly damaging 0.88
IGL00664:Bptf APN 11 107077665 missense possibly damaging 0.78
IGL00705:Bptf APN 11 107095708 splice site probably benign
IGL00796:Bptf APN 11 107054550 missense probably damaging 1.00
IGL00834:Bptf APN 11 107073928 missense possibly damaging 0.59
IGL01155:Bptf APN 11 107080727 missense probably damaging 1.00
IGL01314:Bptf APN 11 107054853 missense probably damaging 1.00
IGL01371:Bptf APN 11 107055907 missense probably benign 0.00
IGL01567:Bptf APN 11 107058774 missense probably damaging 1.00
IGL01794:Bptf APN 11 107053221 critical splice donor site probably null
IGL02108:Bptf APN 11 107074988 missense probably benign 0.45
IGL02367:Bptf APN 11 107073352 missense probably benign
IGL02437:Bptf APN 11 107074695 missense probably benign 0.00
IGL02589:Bptf APN 11 107111531 missense possibly damaging 0.92
IGL02897:Bptf APN 11 107047121 missense probably damaging 1.00
IGL02935:Bptf APN 11 107080799 missense probably damaging 1.00
IGL02954:Bptf APN 11 107054749 missense possibly damaging 0.89
IGL02982:Bptf APN 11 107076674 missense probably damaging 1.00
IGL03109:Bptf APN 11 107061701 missense possibly damaging 0.53
IGL03265:Bptf APN 11 107054628 missense probably benign 0.00
IGL03403:Bptf APN 11 107099733 missense possibly damaging 0.51
Anodyne UTSW 11 107043631 critical splice donor site probably null
Arroyo UTSW 11 107042690 missense probably benign 0.32
mojado UTSW 11 107044640 missense probably benign 0.03
IGL03097:Bptf UTSW 11 107077680 missense probably damaging 1.00
PIT4486001:Bptf UTSW 11 107054788 missense probably damaging 0.98
R0066:Bptf UTSW 11 107062136 missense possibly damaging 0.90
R0157:Bptf UTSW 11 107074658 missense possibly damaging 0.89
R0320:Bptf UTSW 11 107072819 missense probably damaging 1.00
R0328:Bptf UTSW 11 107047127 missense probably damaging 1.00
R0402:Bptf UTSW 11 107074114 missense probably damaging 1.00
R0482:Bptf UTSW 11 107081262 missense probably benign 0.13
R0574:Bptf UTSW 11 107076527 missense probably damaging 1.00
R0598:Bptf UTSW 11 107072965 missense probably damaging 0.99
R0599:Bptf UTSW 11 107068382 missense probably damaging 1.00
R0601:Bptf UTSW 11 107061692 missense probably benign 0.04
R0744:Bptf UTSW 11 107110812 critical splice donor site probably null
R0836:Bptf UTSW 11 107110812 critical splice donor site probably null
R0885:Bptf UTSW 11 107043791 missense probably damaging 1.00
R1070:Bptf UTSW 11 107055055 missense possibly damaging 0.92
R1252:Bptf UTSW 11 107073251 missense probably benign 0.00
R1370:Bptf UTSW 11 107047094 missense probably damaging 0.99
R1428:Bptf UTSW 11 107073047 missense probably damaging 0.99
R1467:Bptf UTSW 11 107055055 missense possibly damaging 0.92
R1467:Bptf UTSW 11 107055055 missense possibly damaging 0.92
R1742:Bptf UTSW 11 107110951 missense probably damaging 1.00
R1816:Bptf UTSW 11 107060579 missense probably damaging 1.00
R1858:Bptf UTSW 11 107073301 missense probably benign 0.00
R1989:Bptf UTSW 11 107074826 missense probably damaging 1.00
R2253:Bptf UTSW 11 107111322 missense probably damaging 1.00
R2392:Bptf UTSW 11 107072747 missense probably damaging 1.00
R2431:Bptf UTSW 11 107047240 missense possibly damaging 0.48
R3022:Bptf UTSW 11 107111637 critical splice acceptor site probably null
R3161:Bptf UTSW 11 107074476 missense probably damaging 1.00
R3686:Bptf UTSW 11 107074198 missense probably benign 0.25
R3687:Bptf UTSW 11 107074198 missense probably benign 0.25
R3688:Bptf UTSW 11 107074198 missense probably benign 0.25
R3787:Bptf UTSW 11 107073827 missense probably damaging 1.00
R3834:Bptf UTSW 11 107073857 missense probably benign 0.05
R3885:Bptf UTSW 11 107074513 missense probably damaging 0.97
R4090:Bptf UTSW 11 107081523 missense probably damaging 0.99
R4398:Bptf UTSW 11 107110844 missense probably damaging 1.00
R4437:Bptf UTSW 11 107074474 missense possibly damaging 0.59
R4514:Bptf UTSW 11 107077692 missense probably damaging 1.00
R4565:Bptf UTSW 11 107073010 missense probably damaging 1.00
R4715:Bptf UTSW 11 107047181 missense probably damaging 1.00
R4748:Bptf UTSW 11 107095880 missense probably damaging 0.96
R4764:Bptf UTSW 11 107043694 missense probably damaging 1.00
R4885:Bptf UTSW 11 107074648 missense probably benign 0.39
R4901:Bptf UTSW 11 107110860 nonsense probably null
R4995:Bptf UTSW 11 107054565 missense probably damaging 0.98
R5057:Bptf UTSW 11 107082528 missense probably damaging 0.98
R5120:Bptf UTSW 11 107073385 missense probably damaging 0.99
R5320:Bptf UTSW 11 107081367 nonsense probably null
R5329:Bptf UTSW 11 107073295 missense probably benign 0.06
R5418:Bptf UTSW 11 107111294 missense probably damaging 1.00
R5461:Bptf UTSW 11 107061764 missense probably damaging 1.00
R5664:Bptf UTSW 11 107073699 missense probably benign 0.01
R5718:Bptf UTSW 11 107111434 missense probably damaging 1.00
R5774:Bptf UTSW 11 107111137 missense probably damaging 1.00
R5851:Bptf UTSW 11 107110862 missense probably damaging 1.00
R5930:Bptf UTSW 11 107073196 missense probably damaging 1.00
R5949:Bptf UTSW 11 107111089 missense probably damaging 0.99
R5975:Bptf UTSW 11 107035864 utr 3 prime probably benign
R6027:Bptf UTSW 11 107074945 missense probably damaging 1.00
R6128:Bptf UTSW 11 107074690 missense possibly damaging 0.87
R6337:Bptf UTSW 11 107058779 missense possibly damaging 0.89
R6407:Bptf UTSW 11 107111126 missense probably damaging 1.00
R6470:Bptf UTSW 11 107072767 missense probably damaging 1.00
R6487:Bptf UTSW 11 107077726 missense probably damaging 0.99
R6501:Bptf UTSW 11 107077683 missense probably null 1.00
R6755:Bptf UTSW 11 107047256 missense probably benign 0.27
R6861:Bptf UTSW 11 107062565 missense probably damaging 1.00
R6866:Bptf UTSW 11 107073580 missense probably damaging 1.00
R6879:Bptf UTSW 11 107042690 missense probably benign 0.32
R6927:Bptf UTSW 11 107054595 missense probably damaging 1.00
R6944:Bptf UTSW 11 107080823 missense probably damaging 1.00
R7082:Bptf UTSW 11 107086747 missense probably benign 0.00
R7136:Bptf UTSW 11 107099715 missense probably damaging 1.00
R7162:Bptf UTSW 11 107043631 critical splice donor site probably null
R7171:Bptf UTSW 11 107131407 missense unknown
R7193:Bptf UTSW 11 107054809 nonsense probably null
R7210:Bptf UTSW 11 107054464 nonsense probably null
R7221:Bptf UTSW 11 107054832 missense probably damaging 1.00
R7316:Bptf UTSW 11 107073109 missense probably damaging 1.00
R7316:Bptf UTSW 11 107110914 nonsense probably null
R7422:Bptf UTSW 11 107060558 missense probably damaging 1.00
R7454:Bptf UTSW 11 107044640 missense probably benign 0.03
R7657:Bptf UTSW 11 107074729 missense probably damaging 1.00
R7718:Bptf UTSW 11 107081456 missense possibly damaging 0.65
R7827:Bptf UTSW 11 107047187 missense probably benign 0.01
R7844:Bptf UTSW 11 107074061 missense probably damaging 0.97
R7992:Bptf UTSW 11 107110883 missense probably benign 0.00
R8001:Bptf UTSW 11 107047340 nonsense probably null
R8037:Bptf UTSW 11 107055950 missense probably damaging 1.00
R8122:Bptf UTSW 11 107036591 critical splice acceptor site probably null
R8235:Bptf UTSW 11 107076632 missense probably benign 0.04
R8308:Bptf UTSW 11 107052989 missense probably damaging 0.99
R8409:Bptf UTSW 11 107062669 missense probably damaging 1.00
R8464:Bptf UTSW 11 107131342 missense probably benign 0.01
R8477:Bptf UTSW 11 107052853 missense probably damaging 0.98
R8482:Bptf UTSW 11 107043698 missense probably benign 0.19
R8515:Bptf UTSW 11 107055238 missense possibly damaging 0.85
R8519:Bptf UTSW 11 107061764 missense probably damaging 1.00
R8708:Bptf UTSW 11 107073313 missense probably damaging 0.99
R8708:Bptf UTSW 11 107073314 missense probably damaging 1.00
R8722:Bptf UTSW 11 107131469 missense unknown
R8732:Bptf UTSW 11 107040380 missense probably damaging 1.00
R8783:Bptf UTSW 11 107131531 missense unknown
R8828:Bptf UTSW 11 107055010 missense probably damaging 0.98
R9004:Bptf UTSW 11 107054887 missense probably damaging 1.00
R9010:Bptf UTSW 11 107073750 missense probably damaging 1.00
R9035:Bptf UTSW 11 107073016 missense probably damaging 1.00
R9083:Bptf UTSW 11 107068350 missense probably damaging 1.00
R9211:Bptf UTSW 11 107055298 missense probably damaging 1.00
R9345:Bptf UTSW 11 107080762 missense possibly damaging 0.77
R9393:Bptf UTSW 11 107074308 missense probably benign 0.00
R9451:Bptf UTSW 11 107044585 missense probably damaging 1.00
R9561:Bptf UTSW 11 107074128 nonsense probably null
R9648:Bptf UTSW 11 107052894 missense probably damaging 0.99
R9650:Bptf UTSW 11 107044586 missense probably benign 0.15
R9658:Bptf UTSW 11 107111344 missense probably damaging 1.00
R9775:Bptf UTSW 11 107043676 missense probably benign 0.04
R9776:Bptf UTSW 11 107078570 missense probably damaging 1.00
Z1088:Bptf UTSW 11 107074582 missense probably benign 0.00
Z1176:Bptf UTSW 11 107058684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCAAATCAGTACTTCATCACAG -3'
(R):5'- ACTGCCTTTCTTTGAAGGGG -3'

Sequencing Primer
(F):5'- GGCTATAGAGAAACCCTGTCTCG -3'
(R):5'- GGGTGGTTCATGTCTTCTTCATCTC -3'
Posted On 2022-09-12