Incidental Mutation 'R0764:Purb'
ID72561
Institutional Source Beutler Lab
Gene Symbol Purb
Ensembl Gene ENSMUSG00000094483
Gene Namepurine rich element binding protein B
SynonymsCager-2, 2310015K15Rik, D11Bwg0414e
MMRRC Submission 038944-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock #R0764 (G1)
Quality Score170
Status Validated
Chromosome11
Chromosomal Location6467599-6475917 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6475661 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 76 (V76M)
Ref Sequence ENSEMBL: ENSMUSP00000136957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179343]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175144
Predicted Effect probably damaging
Transcript: ENSMUST00000179343
AA Change: V76M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136957
Gene: ENSMUSG00000094483
AA Change: V76M

DomainStartEndE-ValueType
low complexity region 11 39 N/A INTRINSIC
PUR 45 107 1.11e-29 SMART
PUR 130 206 1.23e-27 SMART
PUR 231 292 6.56e-23 SMART
low complexity region 304 323 N/A INTRINSIC
Meta Mutation Damage Score 0.3301 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.1%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a sequence-specific, single-stranded DNA-binding protein. It binds preferentially to the single strand of the purine-rich element termed PUR, which is present at origins of replication and in gene flanking regions in a variety of eukaryotes from yeasts through humans. Thus, it is implicated in the control of both DNA replication and transcription. Deletion of this gene has been associated with myelodysplastic syndrome and acute myelogenous leukemia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,059,946 Y898N probably damaging Het
Acp4 T C 7: 44,252,314 probably benign Het
Adipor2 T C 6: 119,357,254 I332V probably benign Het
Ago3 T A 4: 126,355,092 K555N possibly damaging Het
Angpt4 A G 2: 151,911,284 probably benign Het
Ano5 G T 7: 51,537,842 probably benign Het
Ap3b1 C T 13: 94,479,879 probably benign Het
BC025446 T A 15: 75,220,723 F97Y probably benign Het
Cbl A T 9: 44,164,152 C399S probably damaging Het
Cdkl2 C A 5: 92,020,277 V353L probably benign Het
Celsr3 A G 9: 108,827,818 Y500C probably damaging Het
Cep162 A G 9: 87,201,745 S1242P probably damaging Het
Crhr1 C T 11: 104,159,326 R66W probably damaging Het
Ddx49 T C 8: 70,297,257 E170G probably benign Het
Fam193a T C 5: 34,443,341 F305L probably damaging Het
Fam76a C T 4: 132,910,699 G198R probably damaging Het
Gm43302 T A 5: 105,280,489 I130F probably benign Het
Hectd4 T A 5: 121,286,769 I745N possibly damaging Het
Ina T A 19: 47,023,648 *502K probably null Het
Kdm1b A T 13: 47,068,603 D506V possibly damaging Het
Lrrk2 A G 15: 91,775,046 probably null Het
Naip5 A T 13: 100,217,105 D1215E probably benign Het
Neb A G 2: 52,216,867 probably benign Het
Nectin2 T A 7: 19,749,171 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1243 A G 2: 89,527,996 V138A probably benign Het
Olfr170 G T 16: 19,606,432 P79T probably damaging Het
Osbp A G 19: 11,984,156 probably benign Het
Otog A G 7: 46,300,494 D2460G probably benign Het
Pcgf1 T C 6: 83,079,169 C2R probably damaging Het
Per2 C T 1: 91,429,420 V674M probably damaging Het
Pias3 C T 3: 96,701,295 P218S probably damaging Het
Plod3 C T 5: 136,989,583 probably benign Het
Ranbp1 C A 16: 18,240,158 E181* probably null Het
Rit2 T C 18: 31,153,701 probably benign Het
Rnf103 C A 6: 71,509,582 T399K probably damaging Het
Slc22a13 T C 9: 119,208,680 probably null Het
Slc35f4 T A 14: 49,306,339 probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tnfrsf17 C T 16: 11,315,199 T47M possibly damaging Het
Tram1 A G 1: 13,579,709 I97T probably damaging Het
Ttc38 T C 15: 85,846,403 probably benign Het
Zfp113 T A 5: 138,145,244 Q248L probably damaging Het
Other mutations in Purb
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1939:Purb UTSW 11 6474943 missense unknown
R4666:Purb UTSW 11 6475615 missense probably damaging 1.00
R5512:Purb UTSW 11 6475702 missense probably damaging 0.99
R6028:Purb UTSW 11 6475150 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTACTTGCGGTTCTCGCGCAC -3'
(R):5'- CCAGCGGACAGAAACATAGGCTCG -3'

Sequencing Primer
(F):5'- TTCTCGCGCACCAGGAAC -3'
(R):5'- gagaagatggcggacgg -3'
Posted On2013-09-30