Incidental Mutation 'R0764:Crhr1'
ID72562
Institutional Source Beutler Lab
Gene Symbol Crhr1
Ensembl Gene ENSMUSG00000018634
Gene Namecorticotropin releasing hormone receptor 1
SynonymsCRF 1 receptor, CRFR1, CRF-R1alpha
MMRRC Submission 038944-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R0764 (G1)
Quality Score193
Status Validated
Chromosome11
Chromosomal Location104132855-104175523 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104159326 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 66 (R66W)
Ref Sequence ENSEMBL: ENSMUSP00000091455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093925]
Predicted Effect probably damaging
Transcript: ENSMUST00000093925
AA Change: R66W

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091455
Gene: ENSMUSG00000018634
AA Change: R66W

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
HormR 40 111 5.59e-26 SMART
Pfam:7tm_2 116 359 7.2e-81 PFAM
Meta Mutation Damage Score 0.1730 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.1%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: The protein encoded by this gene is a G-protein coupled receptor that binds corticotropin-releasing factor (CRH) and urocortin (UCN) with high affinity. The encoded protein upregulates adenylate cyclase activity and intracellular cAMP levels. This protein is essential for the activation of signal transduction pathways that regulate diverse physiological processes including stress, reproduction, immune response, and obesity. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit agenesis of the adrenal zona fasciculata, low adrenocorticotropic hormone production, and reduced anxiety-related behaviors. Progeny of homozygote matings die from lung dysplasia within 48 hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,059,946 Y898N probably damaging Het
Acp4 T C 7: 44,252,314 probably benign Het
Adipor2 T C 6: 119,357,254 I332V probably benign Het
Ago3 T A 4: 126,355,092 K555N possibly damaging Het
Angpt4 A G 2: 151,911,284 probably benign Het
Ano5 G T 7: 51,537,842 probably benign Het
Ap3b1 C T 13: 94,479,879 probably benign Het
BC025446 T A 15: 75,220,723 F97Y probably benign Het
Cbl A T 9: 44,164,152 C399S probably damaging Het
Cdkl2 C A 5: 92,020,277 V353L probably benign Het
Celsr3 A G 9: 108,827,818 Y500C probably damaging Het
Cep162 A G 9: 87,201,745 S1242P probably damaging Het
Ddx49 T C 8: 70,297,257 E170G probably benign Het
Fam193a T C 5: 34,443,341 F305L probably damaging Het
Fam76a C T 4: 132,910,699 G198R probably damaging Het
Gm43302 T A 5: 105,280,489 I130F probably benign Het
Hectd4 T A 5: 121,286,769 I745N possibly damaging Het
Ina T A 19: 47,023,648 *502K probably null Het
Kdm1b A T 13: 47,068,603 D506V possibly damaging Het
Lrrk2 A G 15: 91,775,046 probably null Het
Naip5 A T 13: 100,217,105 D1215E probably benign Het
Neb A G 2: 52,216,867 probably benign Het
Nectin2 T A 7: 19,749,171 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1243 A G 2: 89,527,996 V138A probably benign Het
Olfr170 G T 16: 19,606,432 P79T probably damaging Het
Osbp A G 19: 11,984,156 probably benign Het
Otog A G 7: 46,300,494 D2460G probably benign Het
Pcgf1 T C 6: 83,079,169 C2R probably damaging Het
Per2 C T 1: 91,429,420 V674M probably damaging Het
Pias3 C T 3: 96,701,295 P218S probably damaging Het
Plod3 C T 5: 136,989,583 probably benign Het
Purb C T 11: 6,475,661 V76M probably damaging Het
Ranbp1 C A 16: 18,240,158 E181* probably null Het
Rit2 T C 18: 31,153,701 probably benign Het
Rnf103 C A 6: 71,509,582 T399K probably damaging Het
Slc22a13 T C 9: 119,208,680 probably null Het
Slc35f4 T A 14: 49,306,339 probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tnfrsf17 C T 16: 11,315,199 T47M possibly damaging Het
Tram1 A G 1: 13,579,709 I97T probably damaging Het
Ttc38 T C 15: 85,846,403 probably benign Het
Zfp113 T A 5: 138,145,244 Q248L probably damaging Het
Other mutations in Crhr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02156:Crhr1 APN 11 104163883 missense probably benign
R1386:Crhr1 UTSW 11 104174394 missense possibly damaging 0.86
R1812:Crhr1 UTSW 11 104169147 missense probably damaging 1.00
R1822:Crhr1 UTSW 11 104133072 start codon destroyed probably benign
R1903:Crhr1 UTSW 11 104169849 missense probably damaging 1.00
R3427:Crhr1 UTSW 11 104173593 critical splice acceptor site probably null
R3930:Crhr1 UTSW 11 104153551 missense probably benign 0.00
R5285:Crhr1 UTSW 11 104170497 missense possibly damaging 0.94
R5537:Crhr1 UTSW 11 104163856 missense possibly damaging 0.94
R6243:Crhr1 UTSW 11 104173914 missense probably damaging 1.00
R6273:Crhr1 UTSW 11 104163856 missense possibly damaging 0.94
R7372:Crhr1 UTSW 11 104163893 splice site probably null
R7664:Crhr1 UTSW 11 104169142 missense probably benign 0.01
X0021:Crhr1 UTSW 11 104169868 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGCCCCTCTGAAGAAAGCGTC -3'
(R):5'- TCTCTGCAAGAATCAGCCCAGAGC -3'

Sequencing Primer
(F):5'- TCTGAAGAAAGCGTCCTTGC -3'
(R):5'- AGCCCAGAGCAAAGCTG -3'
Posted On2013-09-30