Incidental Mutation 'R9633:Slc7a14'
ID 725647
Institutional Source Beutler Lab
Gene Symbol Slc7a14
Ensembl Gene ENSMUSG00000069072
Gene Name solute carrier family 7 (cationic amino acid transporter, y+ system), member 14
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock # R9633 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 31202858-31310378 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 31224017 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 480 (T480S)
Ref Sequence ENSEMBL: ENSMUSP00000088803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091259] [ENSMUST00000108245]
AlphaFold Q8BXR1
Predicted Effect probably benign
Transcript: ENSMUST00000091259
AA Change: T480S

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000088803
Gene: ENSMUSG00000069072
AA Change: T480S

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 443 2.1e-44 PFAM
Pfam:AA_permease 57 436 7.2e-38 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 677 9.2e-21 PFAM
low complexity region 737 757 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108245
AA Change: T480S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000103880
Gene: ENSMUSG00000069072
AA Change: T480S

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 445 2.5e-46 PFAM
Pfam:AA_permease 57 437 6.9e-41 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 668 1.4e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predicted to encode a glycosylated, cationic amino acid transporter protein with 14 transmembrane domains. This gene is primarily expressed in skin fibroblasts, neural tissue, and primary endothelial cells and its protein is predicted to mediate lysosomal uptake of cationic amino acids. Mutations in this gene are associated with autosomal recessive retinitis pigmentosa. In mice, this gene is expressed in the photoreceptor layer of the retina where its expression increases over the course of retinal development and persists in the mature retina. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal eye electrophysiology, thin retinal outer nuclear and decreased total retinal thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 A G 4: 106,755,981 V319A probably damaging Het
Afap1l1 A C 18: 61,757,724 S53A possibly damaging Het
Alms1 T A 6: 85,623,143 N1650K probably damaging Het
Atf6b T A 17: 34,653,533 V553E possibly damaging Het
Avl9 T A 6: 56,730,649 I193N probably damaging Het
Ceacam3 A G 7: 17,161,763 N553D Het
Dnah3 C A 7: 119,950,993 V389L probably benign Het
Erich6 T C 3: 58,629,856 M246V probably benign Het
F830016B08Rik A T 18: 60,299,893 D16V probably damaging Het
Fgfr1 T A 8: 25,570,760 Y483N probably damaging Het
Fmo4 T A 1: 162,803,622 M259L probably benign Het
Gnat2 T A 3: 108,095,454 D59E probably benign Het
Izumo3 T A 4: 92,146,558 Y94F probably damaging Het
Kcnb2 A T 1: 15,711,220 H772L probably benign Het
Kcnrg CACAACAA CACAA 14: 61,607,560 probably benign Het
Krt6b C T 15: 101,678,561 V259M probably benign Het
Lingo2 A G 4: 35,709,885 C32R Het
Lrrtm4 C T 6: 80,023,081 T492M probably damaging Het
Maea T A 5: 33,368,706 M242K possibly damaging Het
Mdga2 T C 12: 66,689,432 T341A probably benign Het
Mfsd14b C A 13: 65,073,600 V293L probably benign Het
Mmadhc A T 2: 50,288,976 S143R probably benign Het
Ms4a8a A G 19: 11,079,592 V42A probably benign Het
N4bp2l2 A T 5: 150,661,638 H292Q probably benign Het
Nkx2-2 A G 2: 147,185,766 Y85H possibly damaging Het
Pramef17 T C 4: 143,994,248 K41R possibly damaging Het
Psmb9 T A 17: 34,183,145 D159V probably damaging Het
Rgs4 T A 1: 169,745,274 D31V possibly damaging Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Slc22a14 A G 9: 119,179,462 S247P probably benign Het
Slc26a7 G A 4: 14,524,540 T448I possibly damaging Het
Spocd1 T C 4: 129,956,670 S830P unknown Het
Sycp2 A G 2: 178,356,461 S1089P probably damaging Het
Tcf4 A T 18: 69,593,311 probably benign Het
Tktl2 T C 8: 66,513,161 V457A probably benign Het
Tmem131 A T 1: 36,807,988 I1343N probably damaging Het
Tnrc6c G A 11: 117,747,183 A1164T probably damaging Het
Tomm5 G A 4: 45,107,982 R18W probably damaging Het
Ubxn7 T C 16: 32,381,430 S335P probably benign Het
Unc5c A C 3: 141,789,893 T508P probably damaging Het
Upp1 G A 11: 9,134,909 M209I Het
Vmn1r213 A G 13: 23,011,349 D34G unknown Het
Vmn1r235 G T 17: 21,262,067 W218L probably benign Het
Vmn1r235 G T 17: 21,262,068 W218C possibly damaging Het
Vmn2r57 T C 7: 41,426,582 E502G probably benign Het
Wwc2 GCC GCCC 8: 47,851,924 probably null Het
Zfc3h1 T A 10: 115,411,947 H1018Q probably damaging Het
Zfp318 T A 17: 46,399,495 S715T probably damaging Het
Other mutations in Slc7a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02631:Slc7a14 APN 3 31238678 missense probably damaging 1.00
IGL02713:Slc7a14 APN 3 31257763 missense probably damaging 0.96
IGL03341:Slc7a14 APN 3 31238770 missense probably damaging 1.00
IGL03350:Slc7a14 APN 3 31237409 missense probably benign 0.35
IGL03379:Slc7a14 APN 3 31223515 missense probably damaging 1.00
R0064:Slc7a14 UTSW 3 31227060 missense probably damaging 1.00
R1549:Slc7a14 UTSW 3 31224118 missense possibly damaging 0.94
R1591:Slc7a14 UTSW 3 31237449 missense probably damaging 1.00
R2054:Slc7a14 UTSW 3 31237362 splice site probably benign
R2057:Slc7a14 UTSW 3 31237496 missense probably damaging 1.00
R2442:Slc7a14 UTSW 3 31230320 missense probably damaging 1.00
R2504:Slc7a14 UTSW 3 31237501 missense possibly damaging 0.85
R3848:Slc7a14 UTSW 3 31237474 missense probably damaging 1.00
R4653:Slc7a14 UTSW 3 31257682 missense probably damaging 1.00
R4702:Slc7a14 UTSW 3 31230398 missense probably damaging 1.00
R5043:Slc7a14 UTSW 3 31237466 missense probably damaging 1.00
R5187:Slc7a14 UTSW 3 31237365 splice site probably null
R5345:Slc7a14 UTSW 3 31223857 missense probably damaging 0.99
R5393:Slc7a14 UTSW 3 31257770 missense probably damaging 1.00
R5421:Slc7a14 UTSW 3 31224197 missense probably damaging 1.00
R5736:Slc7a14 UTSW 3 31223910 missense probably benign 0.00
R5771:Slc7a14 UTSW 3 31238707 missense probably damaging 1.00
R5896:Slc7a14 UTSW 3 31257570 missense probably damaging 1.00
R5996:Slc7a14 UTSW 3 31209236 missense probably benign
R6020:Slc7a14 UTSW 3 31224112 missense probably benign
R6107:Slc7a14 UTSW 3 31257610 missense probably damaging 1.00
R6140:Slc7a14 UTSW 3 31237548 missense probably benign
R6491:Slc7a14 UTSW 3 31223944 missense probably damaging 1.00
R6846:Slc7a14 UTSW 3 31224223 missense probably damaging 1.00
R6990:Slc7a14 UTSW 3 31223579 missense possibly damaging 0.90
R7184:Slc7a14 UTSW 3 31227063 missense probably damaging 0.98
R7271:Slc7a14 UTSW 3 31224235 missense probably damaging 1.00
R7282:Slc7a14 UTSW 3 31227153 missense possibly damaging 0.67
R7331:Slc7a14 UTSW 3 31257731 missense probably benign 0.00
R8227:Slc7a14 UTSW 3 31209212 missense probably benign 0.00
R8238:Slc7a14 UTSW 3 31227151 missense probably benign 0.01
R8524:Slc7a14 UTSW 3 31224133 missense possibly damaging 0.70
R8843:Slc7a14 UTSW 3 31257610 missense probably damaging 1.00
R8903:Slc7a14 UTSW 3 31223446 missense probably damaging 0.98
R9011:Slc7a14 UTSW 3 31224196 missense probably damaging 1.00
R9208:Slc7a14 UTSW 3 31227210 missense probably damaging 1.00
Z1088:Slc7a14 UTSW 3 31223999 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GGTCCGATCAGCTTCTTCAAC -3'
(R):5'- TAGCTTGCATAGTGTCAGGCTTC -3'

Sequencing Primer
(F):5'- CGATCAGCTTCTTCAACTTGATGAG -3'
(R):5'- GACCTCATAGAGATGATGTCCATC -3'
Posted On 2022-09-12