Mutagenetix > Incidental Mutation

Incidental Mutation 'R0764:Ap3b1'

72565

Institutional Source

Beutler Lab

Gene Symbol

Ap3b1

Ensembl Gene

ENSMUSG00000021686

Gene Name

adaptor-related protein complex 3, beta 1 subunit

Synonyms

recombination induced mutation 2, rim2, Hps2, beta3A, AP-3

MMRRC Submission

038944-MU

Accession Numbers

Ap3b1: Ncbi RefSeq: NM_009680; MGI: 1333879;

Essential gene?

Possibly non essential (E-score: 0.441) question?

Stock #

R0764 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

94358960-94566317 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 94479879 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022196]

AlphaFold

Q9Z1T1

Predicted Effect

probably benign
Transcript: ENSMUST00000022196

SMART Domains

Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686

Domain	Start	End	E-Value	Type
low complexity region	10	24	N/A	INTRINSIC
Pfam:Adaptin_N	39	586	1.2e-170	PFAM
Pfam:SEEEED	672	812	1.3e-27	PFAM
AP3B1_C	822	969	1.58e-78	SMART
Blast:B2	993	1103	2e-27	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000231916

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.1%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]

Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	A	T	11: 110,059,946	Y898N	probably damaging	Het
Acp4	T	C	7: 44,252,314		probably benign	Het
Adipor2	T	C	6: 119,357,254	I332V	probably benign	Het
Ago3	T	A	4: 126,355,092	K555N	possibly damaging	Het
Angpt4	A	G	2: 151,911,284		probably benign	Het
Ano5	G	T	7: 51,537,842		probably benign	Het
BC025446	T	A	15: 75,220,723	F97Y	probably benign	Het
Cbl	A	T	9: 44,164,152	C399S	probably damaging	Het
Cdkl2	C	A	5: 92,020,277	V353L	probably benign	Het
Celsr3	A	G	9: 108,827,818	Y500C	probably damaging	Het
Cep162	A	G	9: 87,201,745	S1242P	probably damaging	Het
Crhr1	C	T	11: 104,159,326	R66W	probably damaging	Het
Ddx49	T	C	8: 70,297,257	E170G	probably benign	Het
Fam193a	T	C	5: 34,443,341	F305L	probably damaging	Het
Fam76a	C	T	4: 132,910,699	G198R	probably damaging	Het
Gm43302	T	A	5: 105,280,489	I130F	probably benign	Het
Hectd4	T	A	5: 121,286,769	I745N	possibly damaging	Het
Ina	T	A	19: 47,023,648	*502K	probably null	Het
Kdm1b	A	T	13: 47,068,603	D506V	possibly damaging	Het
Lrrk2	A	G	15: 91,775,046		probably null	Het
Naip5	A	T	13: 100,217,105	D1215E	probably benign	Het
Neb	A	G	2: 52,216,867		probably benign	Het
Nectin2	T	A	7: 19,749,171		probably null	Het
Nup155	A	T	15: 8,157,760	H1391L	probably damaging	Het
Olfr1243	A	G	2: 89,527,996	V138A	probably benign	Het
Olfr170	G	T	16: 19,606,432	P79T	probably damaging	Het
Osbp	A	G	19: 11,984,156		probably benign	Het
Otog	A	G	7: 46,300,494	D2460G	probably benign	Het
Pcgf1	T	C	6: 83,079,169	C2R	probably damaging	Het
Per2	C	T	1: 91,429,420	V674M	probably damaging	Het
Pias3	C	T	3: 96,701,295	P218S	probably damaging	Het
Plod3	C	T	5: 136,989,583		probably benign	Het
Purb	C	T	11: 6,475,661	V76M	probably damaging	Het
Ranbp1	C	A	16: 18,240,158	E181*	probably null	Het
Rit2	T	C	18: 31,153,701		probably benign	Het
Rnf103	C	A	6: 71,509,582	T399K	probably damaging	Het
Slc22a13	T	C	9: 119,208,680		probably null	Het
Slc35f4	T	A	14: 49,306,339		probably benign	Het
Sucla2	C	T	14: 73,560,634		probably benign	Het
Tnfrsf17	C	T	16: 11,315,199	T47M	possibly damaging	Het
Tram1	A	G	1: 13,579,709	I97T	probably damaging	Het
Ttc38	T	C	15: 85,846,403		probably benign	Het
Zfp113	T	A	5: 138,145,244	Q248L	probably damaging	Het

Other mutations in Ap3b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00660:Ap3b1	APN	13	94390863	missense	probably damaging	1.00
IGL00766:Ap3b1	APN	13	94542884	splice site	probably benign
IGL01784:Ap3b1	APN	13	94493739	missense	probably damaging	1.00
IGL01979:Ap3b1	APN	13	94448463	nonsense	probably null
IGL02040:Ap3b1	APN	13	94408845	critical splice donor site	probably null
IGL02119:Ap3b1	APN	13	94462403	missense	probably benign	0.01
IGL02247:Ap3b1	APN	13	94394795	critical splice donor site	probably null
IGL02303:Ap3b1	APN	13	94528319	missense	unknown
IGL02493:Ap3b1	APN	13	94404020	missense	probably damaging	0.98
IGL02551:Ap3b1	APN	13	94418091	missense	probably damaging	0.99
IGL02651:Ap3b1	APN	13	94477021	missense	probably damaging	1.00
IGL02832:Ap3b1	APN	13	94528327	missense	unknown
IGL03033:Ap3b1	APN	13	94448495	missense	probably benign	0.15
IGL03101:Ap3b1	APN	13	94455398	missense	probably benign	0.00
bella	UTSW	13	94528257	missense	unknown
bullet_gray	UTSW	13	94451086	critical splice donor site	probably benign
cuttlefish	UTSW	13	94448451	critical splice acceptor site	probably null
Gastropod	UTSW	13	94542840	missense	unknown
razor	UTSW	13	94493731	missense	unknown
Slime	UTSW	13	94404078	missense	possibly damaging	0.51
slug	UTSW	13	94408845	critical splice donor site	probably null
snail	UTSW	13	94479885	splice site	probably benign
stalk	UTSW	13	94472931	critical splice donor site	probably null
R0034:Ap3b1	UTSW	13	94479885	splice site	probably benign
R0265:Ap3b1	UTSW	13	94493681	missense	unknown
R0270:Ap3b1	UTSW	13	94404118	splice site	probably benign
R0346:Ap3b1	UTSW	13	94445971	nonsense	probably null
R0422:Ap3b1	UTSW	13	94462460	missense	probably damaging	0.99
R0496:Ap3b1	UTSW	13	94472938	splice site	probably benign
R0508:Ap3b1	UTSW	13	94565714	missense	unknown
R1506:Ap3b1	UTSW	13	94446143	splice site	probably benign
R1593:Ap3b1	UTSW	13	94501927	missense	unknown
R1660:Ap3b1	UTSW	13	94408812	missense	probably damaging	0.98
R1735:Ap3b1	UTSW	13	94493717	missense	unknown
R1791:Ap3b1	UTSW	13	94408797	missense	possibly damaging	0.63
R1818:Ap3b1	UTSW	13	94471704	missense	possibly damaging	0.48
R2280:Ap3b1	UTSW	13	94528216	missense	unknown
R3031:Ap3b1	UTSW	13	94565643	missense	unknown
R3037:Ap3b1	UTSW	13	94445978	critical splice donor site	probably null
R4401:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4402:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4403:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4532:Ap3b1	UTSW	13	94565735	missense	unknown
R4624:Ap3b1	UTSW	13	94483226	missense	unknown
R4626:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R4754:Ap3b1	UTSW	13	94403960	missense	probably damaging	1.00
R4788:Ap3b1	UTSW	13	94565641	missense	unknown
R4847:Ap3b1	UTSW	13	94471779	missense	probably benign	0.15
R4886:Ap3b1	UTSW	13	94472805	missense	possibly damaging	0.50
R5096:Ap3b1	UTSW	13	94479849	missense	unknown
R5628:Ap3b1	UTSW	13	94477048	missense	unknown
R5671:Ap3b1	UTSW	13	94528257	missense	unknown
R5677:Ap3b1	UTSW	13	94528196	missense	unknown
R5862:Ap3b1	UTSW	13	94547770	missense	unknown
R5941:Ap3b1	UTSW	13	94440273	missense	probably benign	0.02
R5941:Ap3b1	UTSW	13	94483265	missense	probably damaging	0.96
R6043:Ap3b1	UTSW	13	94476993	missense	probably benign	0.09
R6212:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R6212:Ap3b1	UTSW	13	94493699	missense	unknown
R6301:Ap3b1	UTSW	13	94528295	missense	unknown
R6765:Ap3b1	UTSW	13	94462509	missense	probably benign	0.02
R6812:Ap3b1	UTSW	13	94479861	missense	unknown
R6888:Ap3b1	UTSW	13	94408791	missense	probably benign	0.42
R6901:Ap3b1	UTSW	13	94418142	missense	probably benign	0.00
R7157:Ap3b1	UTSW	13	94532034	nonsense	probably null
R7422:Ap3b1	UTSW	13	94528165	missense	unknown
R7642:Ap3b1	UTSW	13	94477032	missense	probably benign	0.19
R7710:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R7757:Ap3b1	UTSW	13	94528158	splice site	probably null
R7867:Ap3b1	UTSW	13	94483263	missense	unknown
R8492:Ap3b1	UTSW	13	94394786	missense	possibly damaging	0.60
R8706:Ap3b1	UTSW	13	94408845	critical splice donor site	probably null
R8749:Ap3b1	UTSW	13	94528217	missense	unknown
R8876:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R8889:Ap3b1	UTSW	13	94542840	missense	unknown
R8892:Ap3b1	UTSW	13	94542840	missense	unknown
R9065:Ap3b1	UTSW	13	94471715	missense	probably damaging	1.00
R9152:Ap3b1	UTSW	13	94472931	critical splice donor site	probably null
R9152:Ap3b1	UTSW	13	94493731	missense	unknown
R9166:Ap3b1	UTSW	13	94471728	missense	probably damaging	1.00
R9218:Ap3b1	UTSW	13	94448451	critical splice acceptor site	probably null
R9269:Ap3b1	UTSW	13	94404062	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGGCCCATCTAAGTCAGTACCTCC -3'
(R):5'- GCCTTCCAAGGTGAAGATGAACCC -3'

Sequencing Primer
(F):5'- GGTCCTACACGTAGTTAAATGGC -3'
(R):5'- TGAAGATGAACCCTAAGATCTGCTC -3'

Posted On

2013-09-30