Incidental Mutation 'R0764:Slc35f4'
ID72567
Institutional Source Beutler Lab
Gene Symbol Slc35f4
Ensembl Gene ENSMUSG00000021852
Gene Namesolute carrier family 35, member F4
Synonyms
MMRRC Submission 038944-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R0764 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location49298519-49526046 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 49306339 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074368] [ENSMUST00000138884]
Predicted Effect probably benign
Transcript: ENSMUST00000074368
SMART Domains Protein: ENSMUSP00000073972
Gene: ENSMUSG00000021852

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 160 182 N/A INTRINSIC
Pfam:SLC35F 216 435 7.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135254
Predicted Effect probably benign
Transcript: ENSMUST00000138884
SMART Domains Protein: ENSMUSP00000119007
Gene: ENSMUSG00000021852

DomainStartEndE-ValueType
Pfam:EmrE 18 143 1e-12 PFAM
Pfam:EamA 57 135 8.4e-9 PFAM
Pfam:DUF914 68 314 4.8e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228016
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.1%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,059,946 Y898N probably damaging Het
Acp4 T C 7: 44,252,314 probably benign Het
Adipor2 T C 6: 119,357,254 I332V probably benign Het
Ago3 T A 4: 126,355,092 K555N possibly damaging Het
Angpt4 A G 2: 151,911,284 probably benign Het
Ano5 G T 7: 51,537,842 probably benign Het
Ap3b1 C T 13: 94,479,879 probably benign Het
BC025446 T A 15: 75,220,723 F97Y probably benign Het
Cbl A T 9: 44,164,152 C399S probably damaging Het
Cdkl2 C A 5: 92,020,277 V353L probably benign Het
Celsr3 A G 9: 108,827,818 Y500C probably damaging Het
Cep162 A G 9: 87,201,745 S1242P probably damaging Het
Crhr1 C T 11: 104,159,326 R66W probably damaging Het
Ddx49 T C 8: 70,297,257 E170G probably benign Het
Fam193a T C 5: 34,443,341 F305L probably damaging Het
Fam76a C T 4: 132,910,699 G198R probably damaging Het
Gm43302 T A 5: 105,280,489 I130F probably benign Het
Hectd4 T A 5: 121,286,769 I745N possibly damaging Het
Ina T A 19: 47,023,648 *502K probably null Het
Kdm1b A T 13: 47,068,603 D506V possibly damaging Het
Lrrk2 A G 15: 91,775,046 probably null Het
Naip5 A T 13: 100,217,105 D1215E probably benign Het
Neb A G 2: 52,216,867 probably benign Het
Nectin2 T A 7: 19,749,171 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1243 A G 2: 89,527,996 V138A probably benign Het
Olfr170 G T 16: 19,606,432 P79T probably damaging Het
Osbp A G 19: 11,984,156 probably benign Het
Otog A G 7: 46,300,494 D2460G probably benign Het
Pcgf1 T C 6: 83,079,169 C2R probably damaging Het
Per2 C T 1: 91,429,420 V674M probably damaging Het
Pias3 C T 3: 96,701,295 P218S probably damaging Het
Plod3 C T 5: 136,989,583 probably benign Het
Purb C T 11: 6,475,661 V76M probably damaging Het
Ranbp1 C A 16: 18,240,158 E181* probably null Het
Rit2 T C 18: 31,153,701 probably benign Het
Rnf103 C A 6: 71,509,582 T399K probably damaging Het
Slc22a13 T C 9: 119,208,680 probably null Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tnfrsf17 C T 16: 11,315,199 T47M possibly damaging Het
Tram1 A G 1: 13,579,709 I97T probably damaging Het
Ttc38 T C 15: 85,846,403 probably benign Het
Zfp113 T A 5: 138,145,244 Q248L probably damaging Het
Other mutations in Slc35f4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Slc35f4 APN 14 49298877 missense probably benign 0.15
IGL01640:Slc35f4 APN 14 49318768 missense probably damaging 0.99
IGL01942:Slc35f4 APN 14 49525505 splice site probably benign
IGL01990:Slc35f4 APN 14 49304169 critical splice donor site probably null
IGL02097:Slc35f4 APN 14 49306246 missense probably damaging 1.00
IGL02803:Slc35f4 APN 14 49304257 missense probably benign 0.00
R0005:Slc35f4 UTSW 14 49322486 splice site probably benign
R0238:Slc35f4 UTSW 14 49304256 missense possibly damaging 0.78
R0238:Slc35f4 UTSW 14 49304256 missense possibly damaging 0.78
R0239:Slc35f4 UTSW 14 49304256 missense possibly damaging 0.78
R0239:Slc35f4 UTSW 14 49304256 missense possibly damaging 0.78
R1884:Slc35f4 UTSW 14 49313634 missense probably damaging 1.00
R1916:Slc35f4 UTSW 14 49303923 intron probably benign
R2047:Slc35f4 UTSW 14 49303572 intron probably benign
R2239:Slc35f4 UTSW 14 49306203 critical splice donor site probably null
R2380:Slc35f4 UTSW 14 49306203 critical splice donor site probably null
R4273:Slc35f4 UTSW 14 49304301 missense possibly damaging 0.81
R4420:Slc35f4 UTSW 14 49313577 unclassified probably benign
R4425:Slc35f4 UTSW 14 49318850 missense possibly damaging 0.85
R5261:Slc35f4 UTSW 14 49303489 intron probably benign
R5398:Slc35f4 UTSW 14 49298847 missense probably damaging 1.00
R5402:Slc35f4 UTSW 14 49318874 missense probably damaging 1.00
R6310:Slc35f4 UTSW 14 49322457 missense probably damaging 1.00
R6596:Slc35f4 UTSW 14 49525600 missense probably damaging 1.00
R6729:Slc35f4 UTSW 14 49318960 missense probably benign 0.16
R6864:Slc35f4 UTSW 14 49318853 missense possibly damaging 0.55
R7427:Slc35f4 UTSW 14 49298898 missense probably damaging 0.99
R7428:Slc35f4 UTSW 14 49298898 missense probably damaging 0.99
R7559:Slc35f4 UTSW 14 49304275 missense probably benign 0.03
R7596:Slc35f4 UTSW 14 49306209 missense probably damaging 1.00
R7722:Slc35f4 UTSW 14 49306274 missense probably benign 0.22
R8263:Slc35f4 UTSW 14 49313627 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTTAGATGCCCAGCACACAAG -3'
(R):5'- AGGACATCACAAGGATACTGACCCTTC -3'

Sequencing Primer
(F):5'- AACACGCCTGCATTTTTCTAAG -3'
(R):5'- TTCATGGGGCTTACATGGGT -3'
Posted On2013-09-30