Incidental Mutation 'R0764:Sucla2'
ID72568
Institutional Source Beutler Lab
Gene Symbol Sucla2
Ensembl Gene ENSMUSG00000022110
Gene Namesuccinate-Coenzyme A ligase, ADP-forming, beta subunit
Synonyms4930547K18Rik
MMRRC Submission 038944-MU
Accession Numbers

Genbank: NM_011506; MGI: 1306775

Is this an essential gene? Probably essential (E-score: 0.910) question?
Stock #R0764 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location73525319-73596142 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 73560634 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022706] [ENSMUST00000160507] [ENSMUST00000162691]
Predicted Effect probably benign
Transcript: ENSMUST00000022706
SMART Domains Protein: ENSMUSP00000022706
Gene: ENSMUSG00000022110

DomainStartEndE-ValueType
Pfam:ATP-grasp_5 44 277 1.6e-11 PFAM
Pfam:ATP-grasp_2 54 262 9.2e-78 PFAM
Pfam:Ligase_CoA 321 441 2.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160507
SMART Domains Protein: ENSMUSP00000123765
Gene: ENSMUSG00000022110

DomainStartEndE-ValueType
Pfam:ATP-grasp_5 44 277 3e-11 PFAM
Pfam:ATP-grasp_2 54 262 9.5e-77 PFAM
Pfam:Ligase_CoA 321 441 2.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162723
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.1%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Succinyl-CoA synthetase (SCS) is a mitochondrial matrix enzyme that acts as a heterodimer, being composed of an invariant alpha subunit and a substrate-specific beta subunit. The protein encoded by this gene is an ATP-specific SCS beta subunit that dimerizes with the SCS alpha subunit to form SCS-A, an essential component of the tricarboxylic acid cycle. SCS-A hydrolyzes ATP to convert succinate to succinyl-CoA. Defects in this gene are a cause of myopathic mitochondrial DNA depletion syndrome. A pseudogene of this gene has been found on chromosome 6. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit perinatal lethality with reduced size, placenta mineralization, decreased mitochondrial DNA and respiration. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,059,946 Y898N probably damaging Het
Acp4 T C 7: 44,252,314 probably benign Het
Adipor2 T C 6: 119,357,254 I332V probably benign Het
Ago3 T A 4: 126,355,092 K555N possibly damaging Het
Angpt4 A G 2: 151,911,284 probably benign Het
Ano5 G T 7: 51,537,842 probably benign Het
Ap3b1 C T 13: 94,479,879 probably benign Het
BC025446 T A 15: 75,220,723 F97Y probably benign Het
Cbl A T 9: 44,164,152 C399S probably damaging Het
Cdkl2 C A 5: 92,020,277 V353L probably benign Het
Celsr3 A G 9: 108,827,818 Y500C probably damaging Het
Cep162 A G 9: 87,201,745 S1242P probably damaging Het
Crhr1 C T 11: 104,159,326 R66W probably damaging Het
Ddx49 T C 8: 70,297,257 E170G probably benign Het
Fam193a T C 5: 34,443,341 F305L probably damaging Het
Fam76a C T 4: 132,910,699 G198R probably damaging Het
Gm43302 T A 5: 105,280,489 I130F probably benign Het
Hectd4 T A 5: 121,286,769 I745N possibly damaging Het
Ina T A 19: 47,023,648 *502K probably null Het
Kdm1b A T 13: 47,068,603 D506V possibly damaging Het
Lrrk2 A G 15: 91,775,046 probably null Het
Naip5 A T 13: 100,217,105 D1215E probably benign Het
Neb A G 2: 52,216,867 probably benign Het
Nectin2 T A 7: 19,749,171 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1243 A G 2: 89,527,996 V138A probably benign Het
Olfr170 G T 16: 19,606,432 P79T probably damaging Het
Osbp A G 19: 11,984,156 probably benign Het
Otog A G 7: 46,300,494 D2460G probably benign Het
Pcgf1 T C 6: 83,079,169 C2R probably damaging Het
Per2 C T 1: 91,429,420 V674M probably damaging Het
Pias3 C T 3: 96,701,295 P218S probably damaging Het
Plod3 C T 5: 136,989,583 probably benign Het
Purb C T 11: 6,475,661 V76M probably damaging Het
Ranbp1 C A 16: 18,240,158 E181* probably null Het
Rit2 T C 18: 31,153,701 probably benign Het
Rnf103 C A 6: 71,509,582 T399K probably damaging Het
Slc22a13 T C 9: 119,208,680 probably null Het
Slc35f4 T A 14: 49,306,339 probably benign Het
Tnfrsf17 C T 16: 11,315,199 T47M possibly damaging Het
Tram1 A G 1: 13,579,709 I97T probably damaging Het
Ttc38 T C 15: 85,846,403 probably benign Het
Zfp113 T A 5: 138,145,244 Q248L probably damaging Het
Other mutations in Sucla2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Sucla2 APN 14 73590907 missense possibly damaging 0.81
IGL01539:Sucla2 APN 14 73591121 missense probably damaging 0.97
IGL02064:Sucla2 APN 14 73579473 nonsense probably null
IGL02240:Sucla2 APN 14 73590847 missense probably damaging 1.00
IGL02640:Sucla2 APN 14 73581806 missense probably benign 0.45
IGL02965:Sucla2 APN 14 73579431 missense probably benign 0.00
3-1:Sucla2 UTSW 14 73568957 nonsense probably null
PIT4812001:Sucla2 UTSW 14 73579449 missense possibly damaging 0.89
R0189:Sucla2 UTSW 14 73592648 missense probably damaging 1.00
R0765:Sucla2 UTSW 14 73560634 unclassified probably benign
R0844:Sucla2 UTSW 14 73560634 unclassified probably benign
R1065:Sucla2 UTSW 14 73560634 unclassified probably benign
R1067:Sucla2 UTSW 14 73560634 unclassified probably benign
R1136:Sucla2 UTSW 14 73560634 unclassified probably benign
R1162:Sucla2 UTSW 14 73560634 unclassified probably benign
R1311:Sucla2 UTSW 14 73560634 unclassified probably benign
R1312:Sucla2 UTSW 14 73560634 unclassified probably benign
R1345:Sucla2 UTSW 14 73560634 unclassified probably benign
R1416:Sucla2 UTSW 14 73560634 unclassified probably benign
R1677:Sucla2 UTSW 14 73592681 missense probably damaging 1.00
R1968:Sucla2 UTSW 14 73593679 missense probably damaging 0.99
R2126:Sucla2 UTSW 14 73592668 missense possibly damaging 0.71
R2484:Sucla2 UTSW 14 73581709 missense probably benign 0.12
R2566:Sucla2 UTSW 14 73552804 intron probably benign
R3706:Sucla2 UTSW 14 73591052 missense probably damaging 1.00
R4725:Sucla2 UTSW 14 73568989 missense possibly damaging 0.94
R5620:Sucla2 UTSW 14 73595396 missense probably damaging 0.99
R5650:Sucla2 UTSW 14 73591129 missense probably benign 0.38
R5947:Sucla2 UTSW 14 73592669 missense probably damaging 1.00
R6045:Sucla2 UTSW 14 73568964 nonsense probably null
R6236:Sucla2 UTSW 14 73593750 missense probably benign 0.39
R6693:Sucla2 UTSW 14 73568667 nonsense probably null
R7706:Sucla2 UTSW 14 73568993 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACTACAAGTGCAGCAGCAG -3'
(R):5'- GCTAAAAGGAGGACTTCAGCACCC -3'

Sequencing Primer
(F):5'- AGCAGCAGAGGACCCTTTC -3'
(R):5'- TCCTCAAAAACAAGCCaagtcaaac -3'
Posted On2013-09-30