Incidental Mutation 'R0764:Ttc38'
ID72571
Institutional Source Beutler Lab
Gene Symbol Ttc38
Ensembl Gene ENSMUSG00000035944
Gene Nametetratricopeptide repeat domain 38
Synonyms
MMRRC Submission 038944-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0764 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location85832306-85858822 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 85846403 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124011] [ENSMUST00000146088]
Predicted Effect probably benign
Transcript: ENSMUST00000124011
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133158
Predicted Effect probably benign
Transcript: ENSMUST00000146088
SMART Domains Protein: ENSMUSP00000114504
Gene: ENSMUSG00000035944

DomainStartEndE-ValueType
SCOP:d1ld8a_ 105 272 1e-7 SMART
low complexity region 342 354 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.1%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,059,946 Y898N probably damaging Het
Acp4 T C 7: 44,252,314 probably benign Het
Adipor2 T C 6: 119,357,254 I332V probably benign Het
Ago3 T A 4: 126,355,092 K555N possibly damaging Het
Angpt4 A G 2: 151,911,284 probably benign Het
Ano5 G T 7: 51,537,842 probably benign Het
Ap3b1 C T 13: 94,479,879 probably benign Het
BC025446 T A 15: 75,220,723 F97Y probably benign Het
Cbl A T 9: 44,164,152 C399S probably damaging Het
Cdkl2 C A 5: 92,020,277 V353L probably benign Het
Celsr3 A G 9: 108,827,818 Y500C probably damaging Het
Cep162 A G 9: 87,201,745 S1242P probably damaging Het
Crhr1 C T 11: 104,159,326 R66W probably damaging Het
Ddx49 T C 8: 70,297,257 E170G probably benign Het
Fam193a T C 5: 34,443,341 F305L probably damaging Het
Fam76a C T 4: 132,910,699 G198R probably damaging Het
Gm43302 T A 5: 105,280,489 I130F probably benign Het
Hectd4 T A 5: 121,286,769 I745N possibly damaging Het
Ina T A 19: 47,023,648 *502K probably null Het
Kdm1b A T 13: 47,068,603 D506V possibly damaging Het
Lrrk2 A G 15: 91,775,046 probably null Het
Naip5 A T 13: 100,217,105 D1215E probably benign Het
Neb A G 2: 52,216,867 probably benign Het
Nectin2 T A 7: 19,749,171 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1243 A G 2: 89,527,996 V138A probably benign Het
Olfr170 G T 16: 19,606,432 P79T probably damaging Het
Osbp A G 19: 11,984,156 probably benign Het
Otog A G 7: 46,300,494 D2460G probably benign Het
Pcgf1 T C 6: 83,079,169 C2R probably damaging Het
Per2 C T 1: 91,429,420 V674M probably damaging Het
Pias3 C T 3: 96,701,295 P218S probably damaging Het
Plod3 C T 5: 136,989,583 probably benign Het
Purb C T 11: 6,475,661 V76M probably damaging Het
Ranbp1 C A 16: 18,240,158 E181* probably null Het
Rit2 T C 18: 31,153,701 probably benign Het
Rnf103 C A 6: 71,509,582 T399K probably damaging Het
Slc22a13 T C 9: 119,208,680 probably null Het
Slc35f4 T A 14: 49,306,339 probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tnfrsf17 C T 16: 11,315,199 T47M possibly damaging Het
Tram1 A G 1: 13,579,709 I97T probably damaging Het
Zfp113 T A 5: 138,145,244 Q248L probably damaging Het
Other mutations in Ttc38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Ttc38 APN 15 85844462 missense possibly damaging 0.76
IGL01596:Ttc38 APN 15 85836073 missense possibly damaging 0.89
IGL03221:Ttc38 APN 15 85834541 missense probably benign 0.00
PIT4431001:Ttc38 UTSW 15 85836127 missense probably benign
R0040:Ttc38 UTSW 15 85841489 missense probably damaging 1.00
R0040:Ttc38 UTSW 15 85841489 missense probably damaging 1.00
R0081:Ttc38 UTSW 15 85856472 missense probably benign 0.04
R0143:Ttc38 UTSW 15 85853719 missense possibly damaging 0.51
R1745:Ttc38 UTSW 15 85833172 missense probably damaging 1.00
R1837:Ttc38 UTSW 15 85851563 missense probably damaging 1.00
R2069:Ttc38 UTSW 15 85838788 missense probably damaging 1.00
R2086:Ttc38 UTSW 15 85838727 missense probably benign
R2151:Ttc38 UTSW 15 85851601 splice site probably null
R2228:Ttc38 UTSW 15 85844503 missense probably benign 0.01
R4641:Ttc38 UTSW 15 85844458 missense possibly damaging 0.87
R4705:Ttc38 UTSW 15 85852963 missense probably benign 0.00
R4721:Ttc38 UTSW 15 85838746 missense probably benign
R5037:Ttc38 UTSW 15 85844540 missense probably benign 0.16
R6208:Ttc38 UTSW 15 85841497 missense possibly damaging 0.56
R6454:Ttc38 UTSW 15 85838822 missense probably damaging 1.00
R7326:Ttc38 UTSW 15 85852861 missense probably benign 0.00
R7809:Ttc38 UTSW 15 85838738 missense possibly damaging 0.65
R8195:Ttc38 UTSW 15 85844515 nonsense probably null
Predicted Primers PCR Primer
(F):5'- tccccagcccATCTGTACCC -3'
(R):5'- AAGCTCTATGATTGCTGTCTTGCTCC -3'

Sequencing Primer
(F):5'- gcctctgtttctacctccc -3'
(R):5'- ccaaataaaccctttcctcccc -3'
Posted On2013-09-30