Incidental Mutation 'R9634:Olfr916'
ID 725715
Institutional Source Beutler Lab
Gene Symbol Olfr916
Ensembl Gene ENSMUSG00000094701
Gene Name olfactory receptor 916
Synonyms GA_x6K02T2PVTD-32360710-32359778, MOR168-1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.405) question?
Stock # R9634 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 38655052-38659875 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 38657573 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 273 (I273T)
Ref Sequence ENSEMBL: ENSMUSP00000149578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081196] [ENSMUST00000213714] [ENSMUST00000214093] [ENSMUST00000215291]
AlphaFold Q8VG53
Predicted Effect probably benign
Transcript: ENSMUST00000081196
AA Change: I273T

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000079959
Gene: ENSMUSG00000094701
AA Change: I273T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-45 PFAM
Pfam:7tm_1 41 290 1.3e-22 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000214093
AA Change: I273T

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000215291
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca C A 11: 84,293,990 D1277E probably benign Het
Anapc7 T C 5: 122,422,626 S17P probably damaging Het
Atad2b T C 12: 5,010,332 F909S probably damaging Het
Ccnb1 G A 13: 100,783,604 A133V probably benign Het
Chd7 A G 4: 8,832,499 T1125A probably damaging Het
Cyc1 A G 15: 76,343,594 T11A probably benign Het
Ddx59 G A 1: 136,419,476 A291T probably damaging Het
Dgkg T A 16: 22,519,637 probably null Het
Dock8 A G 19: 25,192,221 D1952G probably damaging Het
Dpf3 A G 12: 83,331,861 probably null Het
Evi5 T C 5: 107,816,797 I340V probably benign Het
Extl3 A T 14: 65,077,470 S88T probably damaging Het
Fktn A G 4: 53,761,230 H410R probably benign Het
Fyb2 A T 4: 104,999,382 K596* probably null Het
Gas2l3 C T 10: 89,414,081 A392T probably benign Het
Gbp7 T A 3: 142,536,354 V83E probably benign Het
Gja10 A G 4: 32,601,877 V169A probably damaging Het
Gnao1 A G 8: 93,956,095 H303R probably benign Het
Iars2 A G 1: 185,295,530 *734R probably null Het
Il2ra C T 2: 11,680,416 R188* probably null Het
Inpp5f A C 7: 128,676,791 D435A possibly damaging Het
Ints3 T C 3: 90,411,299 T210A Het
Itpkc A G 7: 27,214,455 I527T probably benign Het
Kcnrg CACAACAA CACAA 14: 61,607,560 probably benign Het
Kdelc1 T C 1: 44,113,036 D271G probably damaging Het
Loxl3 C T 6: 83,050,854 T749I probably benign Het
Lrp1b C T 2: 41,245,939 probably null Het
Ncapg2 T A 12: 116,415,457 H190Q probably damaging Het
Nkain2 G A 10: 32,890,266 P66L unknown Het
Nubpl T C 12: 52,302,711 F242L probably benign Het
Olfr1265 T C 2: 90,037,563 S215P probably damaging Het
Olfr1291-ps1 T C 2: 111,499,786 V178A possibly damaging Het
Paip2b T C 6: 83,810,041 D71G probably damaging Het
Plch1 T C 3: 63,697,731 E1584G probably damaging Het
Prkag2 A G 5: 24,869,240 I489T possibly damaging Het
Ptpn2 C T 18: 67,675,719 probably null Het
Rims3 G A 4: 120,891,320 R246H possibly damaging Het
Sorl1 T G 9: 41,996,294 T1466P probably benign Het
Tbl3 T C 17: 24,707,557 E3G probably benign Het
Tex2 A G 11: 106,568,152 S151P unknown Het
Tmem260 C A 14: 48,472,359 A123E probably damaging Het
Trim45 T C 3: 100,931,990 V736A unknown Het
Vps8 T C 16: 21,554,143 L1033P probably damaging Het
Vwa1 G A 4: 155,772,879 P154L probably damaging Het
Wwc2 GCC GCCC 8: 47,851,924 probably null Het
Ythdc2 A G 18: 44,872,970 T1177A probably benign Het
Zfp36l2 A G 17: 84,186,628 Y194H probably damaging Het
Other mutations in Olfr916
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01965:Olfr916 APN 9 38657622 missense probably benign 0.00
IGL02313:Olfr916 APN 9 38658066 missense probably damaging 0.97
IGL03221:Olfr916 APN 9 38658365 missense probably damaging 0.99
R0479:Olfr916 UTSW 9 38658182 missense probably damaging 1.00
R1507:Olfr916 UTSW 9 38658014 missense probably damaging 1.00
R1521:Olfr916 UTSW 9 38657718 missense probably damaging 0.99
R1860:Olfr916 UTSW 9 38658365 missense probably damaging 0.99
R3107:Olfr916 UTSW 9 38658011 missense possibly damaging 0.48
R3964:Olfr916 UTSW 9 38657727 missense probably benign 0.42
R3965:Olfr916 UTSW 9 38657727 missense probably benign 0.42
R4419:Olfr916 UTSW 9 38658069 missense probably benign 0.01
R5249:Olfr916 UTSW 9 38658078 missense possibly damaging 0.88
R5481:Olfr916 UTSW 9 38657620 missense probably benign 0.00
R6299:Olfr916 UTSW 9 38657777 missense possibly damaging 0.94
R6555:Olfr916 UTSW 9 38658289 missense probably benign 0.00
R6702:Olfr916 UTSW 9 38657777 missense possibly damaging 0.94
R6703:Olfr916 UTSW 9 38657777 missense possibly damaging 0.94
R6851:Olfr916 UTSW 9 38658185 missense probably benign 0.31
R6895:Olfr916 UTSW 9 38658089 missense probably damaging 0.97
R8688:Olfr916 UTSW 9 38657751 missense probably benign 0.24
R8985:Olfr916 UTSW 9 38658325 nonsense probably null
R9259:Olfr916 UTSW 9 38658346 splice site probably benign
R9292:Olfr916 UTSW 9 38657775 missense probably damaging 1.00
R9641:Olfr916 UTSW 9 38657619 missense probably benign 0.00
R9772:Olfr916 UTSW 9 38657668 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTGGACAATATAAGGTCAAACCC -3'
(R):5'- ACCACATATATCAACAAGCTTGTAG -3'

Sequencing Primer
(F):5'- CTGGGATTAAAGGCATGTACCATCAC -3'
(R):5'- CAACAAGCTTGTAGTTTTTGTTGC -3'
Posted On 2022-09-12