Incidental Mutation 'R0764:Ranbp1'
ID72574
Institutional Source Beutler Lab
Gene Symbol Ranbp1
Ensembl Gene ENSMUSG00000005732
Gene NameRAN binding protein 1
SynonymsHtf9a
MMRRC Submission 038944-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0764 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location18239784-18248732 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 18240158 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 181 (E181*)
Ref Sequence ENSEMBL: ENSMUSP00000111309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052325] [ENSMUST00000115645]
Predicted Effect probably null
Transcript: ENSMUST00000052325
AA Change: E131*
SMART Domains Protein: ENSMUSP00000055288
Gene: ENSMUSG00000005732
AA Change: E131*

DomainStartEndE-ValueType
RanBD 1 108 4.92e-46 SMART
coiled coil region 123 153 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115645
AA Change: E181*
SMART Domains Protein: ENSMUSP00000111309
Gene: ENSMUSG00000005732
AA Change: E181*

DomainStartEndE-ValueType
RanBD 27 158 3.33e-75 SMART
low complexity region 183 202 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123073
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.1%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that forms a complex with Ras-related nuclear protein (Ran) and metabolizes guanoside triphosphate (GTP). This complex participates in the regulation of the cell cycle by controlling transport of proteins and nucleic acids into the nucleus. There are multiple pseudogenes for this gene on chromosomes 9, 12, 17, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal growth retardation, decreased body weight, impaired spermatogenesis, and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,059,946 Y898N probably damaging Het
Acp4 T C 7: 44,252,314 probably benign Het
Adipor2 T C 6: 119,357,254 I332V probably benign Het
Ago3 T A 4: 126,355,092 K555N possibly damaging Het
Angpt4 A G 2: 151,911,284 probably benign Het
Ano5 G T 7: 51,537,842 probably benign Het
Ap3b1 C T 13: 94,479,879 probably benign Het
BC025446 T A 15: 75,220,723 F97Y probably benign Het
Cbl A T 9: 44,164,152 C399S probably damaging Het
Cdkl2 C A 5: 92,020,277 V353L probably benign Het
Celsr3 A G 9: 108,827,818 Y500C probably damaging Het
Cep162 A G 9: 87,201,745 S1242P probably damaging Het
Crhr1 C T 11: 104,159,326 R66W probably damaging Het
Ddx49 T C 8: 70,297,257 E170G probably benign Het
Fam193a T C 5: 34,443,341 F305L probably damaging Het
Fam76a C T 4: 132,910,699 G198R probably damaging Het
Gm43302 T A 5: 105,280,489 I130F probably benign Het
Hectd4 T A 5: 121,286,769 I745N possibly damaging Het
Ina T A 19: 47,023,648 *502K probably null Het
Kdm1b A T 13: 47,068,603 D506V possibly damaging Het
Lrrk2 A G 15: 91,775,046 probably null Het
Naip5 A T 13: 100,217,105 D1215E probably benign Het
Neb A G 2: 52,216,867 probably benign Het
Nectin2 T A 7: 19,749,171 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1243 A G 2: 89,527,996 V138A probably benign Het
Olfr170 G T 16: 19,606,432 P79T probably damaging Het
Osbp A G 19: 11,984,156 probably benign Het
Otog A G 7: 46,300,494 D2460G probably benign Het
Pcgf1 T C 6: 83,079,169 C2R probably damaging Het
Per2 C T 1: 91,429,420 V674M probably damaging Het
Pias3 C T 3: 96,701,295 P218S probably damaging Het
Plod3 C T 5: 136,989,583 probably benign Het
Purb C T 11: 6,475,661 V76M probably damaging Het
Rit2 T C 18: 31,153,701 probably benign Het
Rnf103 C A 6: 71,509,582 T399K probably damaging Het
Slc22a13 T C 9: 119,208,680 probably null Het
Slc35f4 T A 14: 49,306,339 probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tnfrsf17 C T 16: 11,315,199 T47M possibly damaging Het
Tram1 A G 1: 13,579,709 I97T probably damaging Het
Ttc38 T C 15: 85,846,403 probably benign Het
Zfp113 T A 5: 138,145,244 Q248L probably damaging Het
Other mutations in Ranbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03165:Ranbp1 APN 16 18247281 unclassified probably benign
R0189:Ranbp1 UTSW 16 18241743 critical splice donor site probably null
R3276:Ranbp1 UTSW 16 18247429 unclassified probably benign
R4381:Ranbp1 UTSW 16 18247344 missense probably damaging 1.00
R4620:Ranbp1 UTSW 16 18240104 unclassified probably benign
R5127:Ranbp1 UTSW 16 18247287 critical splice donor site probably null
R5655:Ranbp1 UTSW 16 18241805 missense probably damaging 1.00
R5965:Ranbp1 UTSW 16 18245228 missense probably damaging 0.97
R7080:Ranbp1 UTSW 16 18245233 missense possibly damaging 0.51
R7900:Ranbp1 UTSW 16 18245297 missense probably damaging 0.97
R7983:Ranbp1 UTSW 16 18245297 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCTGGTCCCTAAGAGCCACAGAAG -3'
(R):5'- GTTAGTAAGTGACCACACATCACCAGC -3'

Sequencing Primer
(F):5'- GCACAGTACATTTTCATGACTGGG -3'
(R):5'- CAGCTTGCTGGACCCATC -3'
Posted On2013-09-30