Incidental Mutation 'R0764:Olfr170'
ID72575
Institutional Source Beutler Lab
Gene Symbol Olfr170
Ensembl Gene ENSMUSG00000062245
Gene Nameolfactory receptor 170
SynonymsGA_x54KRFPKG5P-16052703-16051765, MOR273-2
MMRRC Submission 038944-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R0764 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location19605696-19611882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 19606432 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 79 (P79T)
Ref Sequence ENSEMBL: ENSMUSP00000151806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078603] [ENSMUST00000206562] [ENSMUST00000218837]
Predicted Effect probably damaging
Transcript: ENSMUST00000078603
AA Change: P78T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077674
Gene: ENSMUSG00000062245
AA Change: P78T

DomainStartEndE-ValueType
Pfam:7tm_4 29 308 1.5e-43 PFAM
Pfam:7tm_1 41 290 2.4e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206562
AA Change: P78T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000218837
AA Change: P79T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.3764 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.1%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,059,946 Y898N probably damaging Het
Acp4 T C 7: 44,252,314 probably benign Het
Adipor2 T C 6: 119,357,254 I332V probably benign Het
Ago3 T A 4: 126,355,092 K555N possibly damaging Het
Angpt4 A G 2: 151,911,284 probably benign Het
Ano5 G T 7: 51,537,842 probably benign Het
Ap3b1 C T 13: 94,479,879 probably benign Het
BC025446 T A 15: 75,220,723 F97Y probably benign Het
Cbl A T 9: 44,164,152 C399S probably damaging Het
Cdkl2 C A 5: 92,020,277 V353L probably benign Het
Celsr3 A G 9: 108,827,818 Y500C probably damaging Het
Cep162 A G 9: 87,201,745 S1242P probably damaging Het
Crhr1 C T 11: 104,159,326 R66W probably damaging Het
Ddx49 T C 8: 70,297,257 E170G probably benign Het
Fam193a T C 5: 34,443,341 F305L probably damaging Het
Fam76a C T 4: 132,910,699 G198R probably damaging Het
Gm43302 T A 5: 105,280,489 I130F probably benign Het
Hectd4 T A 5: 121,286,769 I745N possibly damaging Het
Ina T A 19: 47,023,648 *502K probably null Het
Kdm1b A T 13: 47,068,603 D506V possibly damaging Het
Lrrk2 A G 15: 91,775,046 probably null Het
Naip5 A T 13: 100,217,105 D1215E probably benign Het
Neb A G 2: 52,216,867 probably benign Het
Nectin2 T A 7: 19,749,171 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1243 A G 2: 89,527,996 V138A probably benign Het
Osbp A G 19: 11,984,156 probably benign Het
Otog A G 7: 46,300,494 D2460G probably benign Het
Pcgf1 T C 6: 83,079,169 C2R probably damaging Het
Per2 C T 1: 91,429,420 V674M probably damaging Het
Pias3 C T 3: 96,701,295 P218S probably damaging Het
Plod3 C T 5: 136,989,583 probably benign Het
Purb C T 11: 6,475,661 V76M probably damaging Het
Ranbp1 C A 16: 18,240,158 E181* probably null Het
Rit2 T C 18: 31,153,701 probably benign Het
Rnf103 C A 6: 71,509,582 T399K probably damaging Het
Slc22a13 T C 9: 119,208,680 probably null Het
Slc35f4 T A 14: 49,306,339 probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tnfrsf17 C T 16: 11,315,199 T47M possibly damaging Het
Tram1 A G 1: 13,579,709 I97T probably damaging Het
Ttc38 T C 15: 85,846,403 probably benign Het
Zfp113 T A 5: 138,145,244 Q248L probably damaging Het
Other mutations in Olfr170
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01671:Olfr170 APN 16 19605921 missense probably benign 0.00
IGL02002:Olfr170 APN 16 19606550 missense possibly damaging 0.91
IGL02537:Olfr170 APN 16 19605799 missense probably damaging 1.00
IGL02881:Olfr170 APN 16 19606300 missense probably damaging 1.00
IGL03189:Olfr170 APN 16 19606591 missense probably benign
R0012:Olfr170 UTSW 16 19606440 missense probably benign 0.30
R0619:Olfr170 UTSW 16 19606272 missense probably damaging 1.00
R1387:Olfr170 UTSW 16 19606027 missense probably damaging 1.00
R1430:Olfr170 UTSW 16 19606002 missense probably damaging 1.00
R1503:Olfr170 UTSW 16 19606312 missense probably benign 0.19
R1878:Olfr170 UTSW 16 19605751 missense probably benign
R1989:Olfr170 UTSW 16 19606657 missense probably benign 0.00
R2012:Olfr170 UTSW 16 19606131 missense probably benign 0.22
R3890:Olfr170 UTSW 16 19606455 missense probably damaging 1.00
R3891:Olfr170 UTSW 16 19606455 missense probably damaging 1.00
R5591:Olfr170 UTSW 16 19605858 missense probably damaging 1.00
R6158:Olfr170 UTSW 16 19605925 missense probably damaging 1.00
R6297:Olfr170 UTSW 16 19605930 missense possibly damaging 0.81
R6512:Olfr170 UTSW 16 19606359 missense probably damaging 1.00
R6962:Olfr170 UTSW 16 19605922 missense probably benign 0.00
R7252:Olfr170 UTSW 16 19606499 missense probably damaging 0.99
R7605:Olfr170 UTSW 16 19606272 missense probably damaging 1.00
R7687:Olfr170 UTSW 16 19605735 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTCATCAGCACAGGGTAGCAAAG -3'
(R):5'- ACAATGCCCAGGTTCTAGGGAGAG -3'

Sequencing Primer
(F):5'- AGTGGGTGGCAGATGGC -3'
(R):5'- CTGAAGCTCTCTATGAGGCAC -3'
Posted On2013-09-30