Incidental Mutation 'R0764:Rit2'
ID72576
Institutional Source Beutler Lab
Gene Symbol Rit2
Ensembl Gene ENSMUSG00000057455
Gene NameRas-like without CAAX 2
SynonymsRoc2, Rin
MMRRC Submission 038944-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R0764 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location30973489-31317290 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 31153701 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082070] [ENSMUST00000153060]
Predicted Effect probably benign
Transcript: ENSMUST00000082070
SMART Domains Protein: ENSMUSP00000080724
Gene: ENSMUSG00000057455

DomainStartEndE-ValueType
Pfam:Ras 22 65 3.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153060
SMART Domains Protein: ENSMUSP00000114323
Gene: ENSMUSG00000057455

DomainStartEndE-ValueType
RAS 18 184 1.77e-111 SMART
low complexity region 203 212 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153196
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.1%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RIN belongs to the RAS (HRAS; MIM 190020) superfamily of small GTPases (Shao et al., 1999 [PubMed 10545207]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,059,946 Y898N probably damaging Het
Acp4 T C 7: 44,252,314 probably benign Het
Adipor2 T C 6: 119,357,254 I332V probably benign Het
Ago3 T A 4: 126,355,092 K555N possibly damaging Het
Angpt4 A G 2: 151,911,284 probably benign Het
Ano5 G T 7: 51,537,842 probably benign Het
Ap3b1 C T 13: 94,479,879 probably benign Het
BC025446 T A 15: 75,220,723 F97Y probably benign Het
Cbl A T 9: 44,164,152 C399S probably damaging Het
Cdkl2 C A 5: 92,020,277 V353L probably benign Het
Celsr3 A G 9: 108,827,818 Y500C probably damaging Het
Cep162 A G 9: 87,201,745 S1242P probably damaging Het
Crhr1 C T 11: 104,159,326 R66W probably damaging Het
Ddx49 T C 8: 70,297,257 E170G probably benign Het
Fam193a T C 5: 34,443,341 F305L probably damaging Het
Fam76a C T 4: 132,910,699 G198R probably damaging Het
Gm43302 T A 5: 105,280,489 I130F probably benign Het
Hectd4 T A 5: 121,286,769 I745N possibly damaging Het
Ina T A 19: 47,023,648 *502K probably null Het
Kdm1b A T 13: 47,068,603 D506V possibly damaging Het
Lrrk2 A G 15: 91,775,046 probably null Het
Naip5 A T 13: 100,217,105 D1215E probably benign Het
Neb A G 2: 52,216,867 probably benign Het
Nectin2 T A 7: 19,749,171 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1243 A G 2: 89,527,996 V138A probably benign Het
Olfr170 G T 16: 19,606,432 P79T probably damaging Het
Osbp A G 19: 11,984,156 probably benign Het
Otog A G 7: 46,300,494 D2460G probably benign Het
Pcgf1 T C 6: 83,079,169 C2R probably damaging Het
Per2 C T 1: 91,429,420 V674M probably damaging Het
Pias3 C T 3: 96,701,295 P218S probably damaging Het
Plod3 C T 5: 136,989,583 probably benign Het
Purb C T 11: 6,475,661 V76M probably damaging Het
Ranbp1 C A 16: 18,240,158 E181* probably null Het
Rnf103 C A 6: 71,509,582 T399K probably damaging Het
Slc22a13 T C 9: 119,208,680 probably null Het
Slc35f4 T A 14: 49,306,339 probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tnfrsf17 C T 16: 11,315,199 T47M possibly damaging Het
Tram1 A G 1: 13,579,709 I97T probably damaging Het
Ttc38 T C 15: 85,846,403 probably benign Het
Zfp113 T A 5: 138,145,244 Q248L probably damaging Het
Other mutations in Rit2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0456:Rit2 UTSW 18 30975451 missense probably benign 0.00
R1765:Rit2 UTSW 18 31316898 missense probably damaging 0.99
R2142:Rit2 UTSW 18 31153713 missense probably benign 0.00
R4829:Rit2 UTSW 18 31212673 missense probably damaging 1.00
R5137:Rit2 UTSW 18 31153764 missense probably benign
R5350:Rit2 UTSW 18 31316852 missense probably damaging 1.00
R5812:Rit2 UTSW 18 30975461 missense probably damaging 1.00
R7283:Rit2 UTSW 18 31316839 critical splice donor site probably null
R7290:Rit2 UTSW 18 31243168 missense possibly damaging 0.88
R8219:Rit2 UTSW 18 30975494 missense probably damaging 0.97
R8309:Rit2 UTSW 18 31153845 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCACATGAGGTCTGGAACGCAAATG -3'
(R):5'- TCTCCTTTAGGCAGAGTTCACGGC -3'

Sequencing Primer
(F):5'- AGAAGTTCCACAGGCTCATTC -3'
(R):5'- AGAGTTCACGGCCATGC -3'
Posted On2013-09-30