Incidental Mutation 'R0764:Ina'
ID72578
Institutional Source Beutler Lab
Gene Symbol Ina
Ensembl Gene ENSMUSG00000034336
Gene Nameinternexin neuronal intermediate filament protein, alpha
SynonymsNF-66, NF66
MMRRC Submission 038944-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0764 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location47014698-47025327 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to A at 47023648 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Lysine at position 502 (*502K)
Ref Sequence ENSEMBL: ENSMUSP00000041347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037636]
Predicted Effect probably null
Transcript: ENSMUST00000037636
AA Change: *502K
SMART Domains Protein: ENSMUSP00000041347
Gene: ENSMUSG00000034336
AA Change: *502K

DomainStartEndE-ValueType
Pfam:Filament_head 10 92 3.6e-17 PFAM
Filament 93 406 2.36e-141 SMART
low complexity region 417 429 N/A INTRINSIC
low complexity region 440 470 N/A INTRINSIC
Meta Mutation Damage Score 0.8571 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.1%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurofilaments are type IV intermediate filament heteropolymers composed of light, medium, and heavy chains. Neurofilaments comprise the axoskeleton and they functionally maintain the neuronal caliber. They may also play a role in intracellular transport to axons and dendrites. This gene is a member of the intermediate filament family and is involved in the morphogenesis of neurons. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygous mice are healthy and viable, and do not exhibit any obvious abnormalities; no defects in the nervous system were detected, including brain development, axon outgrowth, or guidance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,059,946 Y898N probably damaging Het
Acp4 T C 7: 44,252,314 probably benign Het
Adipor2 T C 6: 119,357,254 I332V probably benign Het
Ago3 T A 4: 126,355,092 K555N possibly damaging Het
Angpt4 A G 2: 151,911,284 probably benign Het
Ano5 G T 7: 51,537,842 probably benign Het
Ap3b1 C T 13: 94,479,879 probably benign Het
BC025446 T A 15: 75,220,723 F97Y probably benign Het
Cbl A T 9: 44,164,152 C399S probably damaging Het
Cdkl2 C A 5: 92,020,277 V353L probably benign Het
Celsr3 A G 9: 108,827,818 Y500C probably damaging Het
Cep162 A G 9: 87,201,745 S1242P probably damaging Het
Crhr1 C T 11: 104,159,326 R66W probably damaging Het
Ddx49 T C 8: 70,297,257 E170G probably benign Het
Fam193a T C 5: 34,443,341 F305L probably damaging Het
Fam76a C T 4: 132,910,699 G198R probably damaging Het
Gm43302 T A 5: 105,280,489 I130F probably benign Het
Hectd4 T A 5: 121,286,769 I745N possibly damaging Het
Kdm1b A T 13: 47,068,603 D506V possibly damaging Het
Lrrk2 A G 15: 91,775,046 probably null Het
Naip5 A T 13: 100,217,105 D1215E probably benign Het
Neb A G 2: 52,216,867 probably benign Het
Nectin2 T A 7: 19,749,171 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1243 A G 2: 89,527,996 V138A probably benign Het
Olfr170 G T 16: 19,606,432 P79T probably damaging Het
Osbp A G 19: 11,984,156 probably benign Het
Otog A G 7: 46,300,494 D2460G probably benign Het
Pcgf1 T C 6: 83,079,169 C2R probably damaging Het
Per2 C T 1: 91,429,420 V674M probably damaging Het
Pias3 C T 3: 96,701,295 P218S probably damaging Het
Plod3 C T 5: 136,989,583 probably benign Het
Purb C T 11: 6,475,661 V76M probably damaging Het
Ranbp1 C A 16: 18,240,158 E181* probably null Het
Rit2 T C 18: 31,153,701 probably benign Het
Rnf103 C A 6: 71,509,582 T399K probably damaging Het
Slc22a13 T C 9: 119,208,680 probably null Het
Slc35f4 T A 14: 49,306,339 probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tnfrsf17 C T 16: 11,315,199 T47M possibly damaging Het
Tram1 A G 1: 13,579,709 I97T probably damaging Het
Ttc38 T C 15: 85,846,403 probably benign Het
Zfp113 T A 5: 138,145,244 Q248L probably damaging Het
Other mutations in Ina
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01539:Ina APN 19 47015464 missense probably damaging 0.96
IGL01544:Ina APN 19 47015509 missense possibly damaging 0.76
IGL02263:Ina APN 19 47015487 missense probably damaging 1.00
R0086:Ina UTSW 19 47023591 missense possibly damaging 0.94
R0395:Ina UTSW 19 47021919 missense probably damaging 1.00
R0570:Ina UTSW 19 47023499 missense probably benign
R3727:Ina UTSW 19 47015719 missense possibly damaging 0.48
R5160:Ina UTSW 19 47015080 missense probably damaging 1.00
R6376:Ina UTSW 19 47015125 missense probably benign 0.00
R6455:Ina UTSW 19 47023561 missense probably benign 0.13
R6770:Ina UTSW 19 47014927 utr 5 prime probably benign
R7709:Ina UTSW 19 47023643 missense
R7882:Ina UTSW 19 47015661 missense
Z1177:Ina UTSW 19 47014911 missense
Predicted Primers PCR Primer
(F):5'- TCCCAGAATCCTTAGCTCTACAGCC -3'
(R):5'- GTGAGGGATGAGCAGATTTAGCACC -3'

Sequencing Primer
(F):5'- TTAGCTCTACAGCCTCCAAAGTC -3'
(R):5'- AAAGCTGTGTTCTTGGAGAACTC -3'
Posted On2013-09-30