Incidental Mutation 'R9636:Rbbp6'
ID 725795
Institutional Source Beutler Lab
Gene Symbol Rbbp6
Ensembl Gene ENSMUSG00000030779
Gene Name retinoblastoma binding protein 6, ubiquitin ligase
Synonyms C030034J04Rik, 4933422O15Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9636 (G1)
Quality Score 177.468
Status Not validated
Chromosome 7
Chromosomal Location 122965686-123002557 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) AAAGAAGAAGAAGAAGAAG to AAAGAAGAAGAAGAAG at 123001952 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052135] [ENSMUST00000071590] [ENSMUST00000205495] [ENSMUST00000231323]
AlphaFold P97868
Predicted Effect probably benign
Transcript: ENSMUST00000052135
SMART Domains Protein: ENSMUSP00000049528
Gene: ENSMUSG00000030779

DomainStartEndE-ValueType
DWNN 4 76 3.92e-42 SMART
low complexity region 101 110 N/A INTRINSIC
ZnF_C2HC 161 177 5.67e-5 SMART
low complexity region 233 259 N/A INTRINSIC
RING 260 300 6.05e-4 SMART
low complexity region 338 349 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 474 485 N/A INTRINSIC
low complexity region 551 610 N/A INTRINSIC
coiled coil region 653 679 N/A INTRINSIC
low complexity region 680 774 N/A INTRINSIC
low complexity region 824 844 N/A INTRINSIC
low complexity region 929 943 N/A INTRINSIC
low complexity region 1003 1025 N/A INTRINSIC
internal_repeat_2 1026 1091 4.38e-6 PROSPERO
internal_repeat_1 1038 1107 3.76e-7 PROSPERO
low complexity region 1120 1141 N/A INTRINSIC
low complexity region 1143 1154 N/A INTRINSIC
low complexity region 1247 1258 N/A INTRINSIC
internal_repeat_2 1395 1466 4.38e-6 PROSPERO
low complexity region 1472 1490 N/A INTRINSIC
internal_repeat_1 1523 1586 3.76e-7 PROSPERO
low complexity region 1689 1752 N/A INTRINSIC
low complexity region 1758 1784 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071590
SMART Domains Protein: ENSMUSP00000071519
Gene: ENSMUSG00000030779

DomainStartEndE-ValueType
DWNN 4 76 3.92e-42 SMART
low complexity region 101 110 N/A INTRINSIC
ZnF_C2HC 161 177 5.67e-5 SMART
low complexity region 233 259 N/A INTRINSIC
RING 260 300 6.05e-4 SMART
low complexity region 338 349 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 474 485 N/A INTRINSIC
low complexity region 551 610 N/A INTRINSIC
low complexity region 653 740 N/A INTRINSIC
low complexity region 790 810 N/A INTRINSIC
low complexity region 895 909 N/A INTRINSIC
low complexity region 969 991 N/A INTRINSIC
internal_repeat_2 992 1057 5.65e-6 PROSPERO
internal_repeat_1 1004 1073 5.01e-7 PROSPERO
low complexity region 1086 1107 N/A INTRINSIC
low complexity region 1109 1120 N/A INTRINSIC
low complexity region 1213 1224 N/A INTRINSIC
internal_repeat_2 1361 1432 5.65e-6 PROSPERO
low complexity region 1438 1456 N/A INTRINSIC
internal_repeat_1 1489 1552 5.01e-7 PROSPERO
low complexity region 1655 1718 N/A INTRINSIC
low complexity region 1724 1750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205495
Predicted Effect probably benign
Transcript: ENSMUST00000231323
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The retinoblastoma tumor suppressor (pRB) protein binds with many other proteins. In various human cancers, pRB suppresses cellular proliferation and is inactivated. Cell cycle-dependent phosphorylation regulates the activity of pRB. This gene encodes a protein which binds to underphosphorylated but not phosphorylated pRB. Multiple alternatively spliced transcript variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality, reduced size, growth retardation and increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,160,996 I48M probably benign Het
Arnt2 T G 7: 84,343,834 E177A probably benign Het
Atad3a T C 4: 155,749,159 T421A possibly damaging Het
Cdh6 A G 15: 13,057,569 L222P probably benign Het
Celf3 A G 3: 94,487,273 H304R possibly damaging Het
Ces1a T C 8: 93,032,635 E291G probably benign Het
Dicer1 C T 12: 104,722,147 W390* probably null Het
Fsip2 A T 2: 82,990,219 Q5432L possibly damaging Het
Gm12830 T C 4: 114,841,662 S73P Het
Hyal5 A G 6: 24,876,657 I176M possibly damaging Het
Ifna7 T C 4: 88,816,496 I90T possibly damaging Het
Klhl3 T C 13: 58,051,049 T259A probably damaging Het
Kpna3 A G 14: 61,387,454 S147P probably damaging Het
Lama4 A G 10: 39,080,504 D1141G possibly damaging Het
Letm2 T C 8: 25,593,703 I171V probably benign Het
Nfatc1 T A 18: 80,663,396 Q602L possibly damaging Het
Olfr1295 A T 2: 111,565,441 M1K probably null Het
Olfr155 T A 4: 43,854,898 N196K probably damaging Het
Ppp4r4 T C 12: 103,598,429 V18A unknown Het
Prkdc G A 16: 15,730,477 R1983H probably benign Het
Ptprz1 A G 6: 22,999,995 R695G probably benign Het
Riok1 T C 13: 38,058,743 probably null Het
Rnf180 T A 13: 105,250,311 H164L possibly damaging Het
Slc2a3 A G 6: 122,732,403 S346P probably damaging Het
Slit3 A T 11: 35,703,261 D1426V probably damaging Het
Try10 A G 6: 41,355,571 N54D probably benign Het
Vmn2r71 T C 7: 85,619,180 V197A possibly damaging Het
Wdfy3 C A 5: 101,900,033 R1802L probably benign Het
Zfyve16 T C 13: 92,494,948 R1380G probably benign Het
Other mutations in Rbbp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Rbbp6 APN 7 122988685 missense probably damaging 1.00
IGL00561:Rbbp6 APN 7 122971063 missense probably damaging 1.00
IGL01144:Rbbp6 APN 7 122975946 missense possibly damaging 0.95
IGL01325:Rbbp6 APN 7 122988618 missense probably damaging 1.00
IGL01520:Rbbp6 APN 7 122985675 missense possibly damaging 0.93
IGL01765:Rbbp6 APN 7 122999954 unclassified probably benign
IGL01985:Rbbp6 APN 7 122971073 missense probably damaging 1.00
IGL02094:Rbbp6 APN 7 122997262 missense probably damaging 1.00
IGL02125:Rbbp6 APN 7 122971129 critical splice donor site probably null
IGL02552:Rbbp6 APN 7 122982981 missense probably damaging 0.98
IGL02805:Rbbp6 APN 7 123001188 utr 3 prime probably benign
changeling UTSW 7 122997311 splice site probably null
Puzzlewit UTSW 7 122999808 unclassified probably benign
R0403:Rbbp6 UTSW 7 122992296 missense probably damaging 0.99
R0855:Rbbp6 UTSW 7 122992248 missense probably benign 0.22
R1132:Rbbp6 UTSW 7 123000113 unclassified probably benign
R1463:Rbbp6 UTSW 7 122992453 missense possibly damaging 0.89
R1867:Rbbp6 UTSW 7 122997029 missense probably damaging 1.00
R1957:Rbbp6 UTSW 7 122990288 missense probably benign 0.04
R1958:Rbbp6 UTSW 7 123001945 unclassified probably benign
R1978:Rbbp6 UTSW 7 122999488 unclassified probably benign
R1999:Rbbp6 UTSW 7 122990352 missense probably damaging 0.98
R2164:Rbbp6 UTSW 7 122999474 unclassified probably benign
R4181:Rbbp6 UTSW 7 122994735 missense probably damaging 0.99
R4387:Rbbp6 UTSW 7 122997311 splice site probably null
R4583:Rbbp6 UTSW 7 123001952 unclassified probably benign
R4936:Rbbp6 UTSW 7 122999703 unclassified probably benign
R4974:Rbbp6 UTSW 7 122999808 unclassified probably benign
R4998:Rbbp6 UTSW 7 122990326 missense probably benign 0.36
R5082:Rbbp6 UTSW 7 123000702 utr 3 prime probably benign
R5502:Rbbp6 UTSW 7 122988724 missense probably damaging 1.00
R5567:Rbbp6 UTSW 7 123001834 utr 3 prime probably benign
R5570:Rbbp6 UTSW 7 123001834 utr 3 prime probably benign
R5607:Rbbp6 UTSW 7 122997086 missense probably damaging 1.00
R5608:Rbbp6 UTSW 7 122997086 missense probably damaging 1.00
R5948:Rbbp6 UTSW 7 122997628 missense probably damaging 1.00
R6134:Rbbp6 UTSW 7 122997311 splice site probably null
R6172:Rbbp6 UTSW 7 122998555 nonsense probably null
R6773:Rbbp6 UTSW 7 122999355 unclassified probably benign
R6800:Rbbp6 UTSW 7 122985064 missense possibly damaging 0.93
R7266:Rbbp6 UTSW 7 123001367 missense unknown
R7298:Rbbp6 UTSW 7 123001194 missense unknown
R7535:Rbbp6 UTSW 7 122990143 missense probably benign 0.00
R7635:Rbbp6 UTSW 7 122976008 missense possibly damaging 0.80
R7665:Rbbp6 UTSW 7 122994686 missense possibly damaging 0.81
R7665:Rbbp6 UTSW 7 122990032 splice site probably null
R7910:Rbbp6 UTSW 7 122997028 missense possibly damaging 0.48
R7956:Rbbp6 UTSW 7 123001338 missense unknown
R8043:Rbbp6 UTSW 7 122985245 missense probably damaging 1.00
R8273:Rbbp6 UTSW 7 122990324 missense probably benign 0.36
R8473:Rbbp6 UTSW 7 123001198 utr 3 prime probably benign
R8679:Rbbp6 UTSW 7 123001293 missense unknown
R8712:Rbbp6 UTSW 7 123001753 missense unknown
R8802:Rbbp6 UTSW 7 122988457 intron probably benign
R8911:Rbbp6 UTSW 7 122992045 missense possibly damaging 0.53
R9152:Rbbp6 UTSW 7 123001474 missense unknown
R9159:Rbbp6 UTSW 7 122990205 missense probably damaging 0.99
R9308:Rbbp6 UTSW 7 122996998 missense probably damaging 1.00
R9438:Rbbp6 UTSW 7 123000233 missense
R9509:Rbbp6 UTSW 7 122998568 missense unknown
R9608:Rbbp6 UTSW 7 122992045 missense possibly damaging 0.53
R9707:Rbbp6 UTSW 7 122989838 missense probably damaging 1.00
X0062:Rbbp6 UTSW 7 123000146 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTTGCCAGTATCTCCAAGGAC -3'
(R):5'- CGTCCTTCACACAGTGACAG -3'

Sequencing Primer
(F):5'- TGCCAGTATCTCCAAGGACTTGAAAG -3'
(R):5'- GTCCTTCACACAGTGACAGATCTC -3'
Posted On 2022-09-12