Incidental Mutation 'R9636:Ces1a'
ID 725797
Institutional Source Beutler Lab
Gene Symbol Ces1a
Ensembl Gene ENSMUSG00000071047
Gene Name carboxylesterase 1A
Synonyms Gm4976
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9636 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 93020214-93048192 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 93032635 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 291 (E291G)
Ref Sequence ENSEMBL: ENSMUSP00000092836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095211]
AlphaFold E9PYP1
Predicted Effect probably benign
Transcript: ENSMUST00000095211
AA Change: E291G

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000092836
Gene: ENSMUSG00000071047
AA Change: E291G

DomainStartEndE-ValueType
Pfam:COesterase 1 545 5.7e-169 PFAM
Pfam:Abhydrolase_3 136 286 8.4e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,160,996 I48M probably benign Het
Arnt2 T G 7: 84,343,834 E177A probably benign Het
Atad3a T C 4: 155,749,159 T421A possibly damaging Het
Cdh6 A G 15: 13,057,569 L222P probably benign Het
Celf3 A G 3: 94,487,273 H304R possibly damaging Het
Dicer1 C T 12: 104,722,147 W390* probably null Het
Fsip2 A T 2: 82,990,219 Q5432L possibly damaging Het
Gm12830 T C 4: 114,841,662 S73P Het
Hyal5 A G 6: 24,876,657 I176M possibly damaging Het
Ifna7 T C 4: 88,816,496 I90T possibly damaging Het
Klhl3 T C 13: 58,051,049 T259A probably damaging Het
Kpna3 A G 14: 61,387,454 S147P probably damaging Het
Lama4 A G 10: 39,080,504 D1141G possibly damaging Het
Letm2 T C 8: 25,593,703 I171V probably benign Het
Nfatc1 T A 18: 80,663,396 Q602L possibly damaging Het
Olfr1295 A T 2: 111,565,441 M1K probably null Het
Olfr155 T A 4: 43,854,898 N196K probably damaging Het
Ppp4r4 T C 12: 103,598,429 V18A unknown Het
Prkdc G A 16: 15,730,477 R1983H probably benign Het
Ptprz1 A G 6: 22,999,995 R695G probably benign Het
Rbbp6 AAAGAAGAAGAAGAAGAAG AAAGAAGAAGAAGAAG 7: 123,001,952 probably benign Het
Riok1 T C 13: 38,058,743 probably null Het
Rnf180 T A 13: 105,250,311 H164L possibly damaging Het
Slc2a3 A G 6: 122,732,403 S346P probably damaging Het
Slit3 A T 11: 35,703,261 D1426V probably damaging Het
Try10 A G 6: 41,355,571 N54D probably benign Het
Vmn2r71 T C 7: 85,619,180 V197A possibly damaging Het
Wdfy3 C A 5: 101,900,033 R1802L probably benign Het
Zfyve16 T C 13: 92,494,948 R1380G probably benign Het
Other mutations in Ces1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Ces1a APN 8 93020467 missense probably damaging 1.00
IGL00556:Ces1a APN 8 93045059 missense probably benign 0.03
IGL00841:Ces1a APN 8 93039536 nonsense probably null
IGL01510:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01511:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01518:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01519:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01520:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01526:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01527:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01828:Ces1a APN 8 93025201 missense probably damaging 0.96
IGL01934:Ces1a APN 8 93032650 missense probably damaging 0.99
IGL02456:Ces1a APN 8 93039498 missense possibly damaging 0.56
IGL02712:Ces1a APN 8 93036040 missense probably damaging 1.00
IGL02982:Ces1a APN 8 93044975 missense probably damaging 1.00
IGL03178:Ces1a APN 8 93020889 missense probably damaging 1.00
IGL03377:Ces1a APN 8 93039488 missense probably damaging 1.00
R0556:Ces1a UTSW 8 93045112 missense probably benign 0.01
R0613:Ces1a UTSW 8 93025581 missense probably benign 0.11
R0627:Ces1a UTSW 8 93042043 missense probably benign 0.03
R0686:Ces1a UTSW 8 93022449 missense probably damaging 1.00
R0724:Ces1a UTSW 8 93039513 missense probably damaging 0.98
R0930:Ces1a UTSW 8 93022416 missense probably benign 0.00
R1063:Ces1a UTSW 8 93022416 missense probably benign 0.00
R1215:Ces1a UTSW 8 93032690 missense probably damaging 1.00
R1381:Ces1a UTSW 8 93034031 missense probably damaging 0.98
R1417:Ces1a UTSW 8 93022416 missense probably benign 0.00
R1850:Ces1a UTSW 8 93027326 missense probably damaging 1.00
R2072:Ces1a UTSW 8 93048075 missense probably benign 0.29
R2074:Ces1a UTSW 8 93048075 missense probably benign 0.29
R2075:Ces1a UTSW 8 93048075 missense probably benign 0.29
R2114:Ces1a UTSW 8 93039551 missense possibly damaging 0.93
R2213:Ces1a UTSW 8 93025225 missense probably damaging 1.00
R2346:Ces1a UTSW 8 93025319 missense probably benign 0.07
R2347:Ces1a UTSW 8 93025319 missense probably benign 0.07
R2483:Ces1a UTSW 8 93027341 missense probably damaging 1.00
R4515:Ces1a UTSW 8 93020904 missense probably damaging 1.00
R4587:Ces1a UTSW 8 93025304 missense probably damaging 1.00
R4691:Ces1a UTSW 8 93032659 missense probably benign 0.00
R4992:Ces1a UTSW 8 93045022 missense probably benign 0.08
R5074:Ces1a UTSW 8 93032675 missense possibly damaging 0.77
R6086:Ces1a UTSW 8 93027353 missense probably benign 0.03
R7390:Ces1a UTSW 8 93044841 splice site probably null
R8926:Ces1a UTSW 8 93025213 missense probably benign 0.05
R9365:Ces1a UTSW 8 93048099 missense probably benign 0.00
R9582:Ces1a UTSW 8 93039528 missense probably benign 0.33
Z1088:Ces1a UTSW 8 93025607 missense probably benign 0.02
Z1176:Ces1a UTSW 8 93036085 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- ACCACTGTTTTGGGAACTCTGG -3'
(R):5'- CCAGAACTGGGCTTGAGATAG -3'

Sequencing Primer
(F):5'- GGAACTCTGGGATATTGTTATGC -3'
(R):5'- AACTGGGCTTGAGATAGCATCCC -3'
Posted On 2022-09-12