Mutagenetix > Incidental Mutation

Incidental Mutation 'R0765:Zdbf2'

72581

Institutional Source

Beutler Lab

Gene Symbol

Zdbf2

Ensembl Gene

ENSMUSG00000027520

Gene Name

zinc finger, DBF-type containing 2

Synonyms

4930431J08Rik, 9330107J05Rik

MMRRC Submission

038945-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R0765 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63273265-63314576 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 63305723 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 1087 (S1087N)

Ref Sequence

ENSEMBL: ENSMUSP00000109767 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]

AlphaFold

Q5SS00

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029025
AA Change: S1087N

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: S1087N

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114132
AA Change: S1087N

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: S1087N

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.8%
20x: 92.7%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830010M20Rik	T	A	5: 107,506,934	D354E	probably benign	Het
Abhd16a	T	A	17: 35,101,851	V425D	probably benign	Het
Ano9	T	G	7: 141,107,184	I381L	probably damaging	Het
Apob	C	T	12: 8,016,518	L4496F	probably benign	Het
Arhgef38	C	T	3: 133,116,583	E724K	probably damaging	Het
Atp8b4	T	A	2: 126,372,150		probably null	Het
Baiap2l1	G	T	5: 144,277,703	P394T	probably damaging	Het
Cnbp	C	A	6: 87,845,173	C122F	probably damaging	Het
Col3a1	A	G	1: 45,336,651		probably benign	Het
Colq	T	G	14: 31,526,037	D408A	possibly damaging	Het
Cuzd1	A	T	7: 131,316,095	S259T	probably benign	Het
Cyp3a57	A	G	5: 145,390,410		probably benign	Het
Dbn1	C	A	13: 55,482,294	V112F	probably damaging	Het
Dcc	T	A	18: 71,362,990	D1028V	probably damaging	Het
Dnajb11	T	C	16: 22,862,568	V32A	probably damaging	Het
Dsg4	G	A	18: 20,454,646		probably benign	Het
Dyrk1b	C	T	7: 28,185,711		probably benign	Het
Ebf1	T	A	11: 44,869,160	M208K	probably damaging	Het
Efhc1	A	G	1: 20,978,652	I430V	probably benign	Het
Elovl2	T	C	13: 41,187,466	Y181C	probably benign	Het
Fras1	A	G	5: 96,552,796	Q225R	probably benign	Het
Frmd3	G	A	4: 74,161,767	R332Q	probably damaging	Het
Glg1	A	G	8: 111,159,797		probably null	Het
Hmcn1	G	A	1: 150,808,787	T344M	probably damaging	Het
Il1rap	T	G	16: 26,710,632		probably null	Het
Klra1	A	T	6: 130,379,092		probably benign	Het
Larp7	C	A	3: 127,546,165	K289N	probably damaging	Het
Lgr6	C	A	1: 134,993,886	G240V	probably benign	Het
Lrp10	G	T	14: 54,468,090	D246Y	probably damaging	Het
Map3k20	G	A	2: 72,371,925	V167I	probably damaging	Het
Med23	T	C	10: 24,900,710	S347P	probably damaging	Het
Mybph	T	C	1: 134,197,496	V254A	possibly damaging	Het
Ndufv2	A	G	17: 66,101,078		probably benign	Het
Nuf2	A	T	1: 169,522,936		probably benign	Het
Nup210l	T	C	3: 90,119,877	Y189H	probably damaging	Het
Olfr1025-ps1	T	C	2: 85,918,705	L260P	probably damaging	Het
Olfr1263	G	A	2: 90,015,670	V247I	probably benign	Het
Olfr574	C	T	7: 102,948,732	T79I	probably damaging	Het
Pdgfra	C	A	5: 75,187,987		probably benign	Het
Phlpp1	T	C	1: 106,392,283	L1336P	probably damaging	Het
Prpf38b	T	C	3: 108,911,418	T9A	possibly damaging	Het
Rnf213	G	A	11: 119,423,095		probably null	Het
Saal1	A	T	7: 46,699,647	V281E	possibly damaging	Het
Slc17a3	C	T	13: 23,846,896	Q186*	probably null	Het
Slc6a2	A	G	8: 92,989,031	T266A	probably damaging	Het
Snai2	T	C	16: 14,706,804	V58A	possibly damaging	Het
Srfbp1	T	C	18: 52,490,435		probably benign	Het
Sucla2	C	T	14: 73,560,634		probably benign	Het
Tesk1	C	T	4: 43,446,706	P365S	possibly damaging	Het
Tmem127	C	A	2: 127,257,149	T201K	probably damaging	Het
Trim17	T	G	11: 58,971,369	V409G	possibly damaging	Het
Trim43c	C	T	9: 88,841,916	T165I	probably benign	Het
Ush2a	C	A	1: 188,948,574	F4916L	possibly damaging	Het
Vmn1r89	A	G	7: 13,219,540	M68V	probably benign	Het
Vmn2r105	C	T	17: 20,227,711	E284K	probably benign	Het
Vmn2r105	T	C	17: 20,227,857	D235G	probably damaging	Het
Vmn2r-ps134	C	T	17: 23,446,041		noncoding transcript	Het
Zfp534	G	A	4: 147,674,236	P659S	probably damaging	Het

Other mutations in Zdbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Zdbf2	APN	1	63306514	missense	possibly damaging	0.92
IGL00796:Zdbf2	APN	1	63307205	missense	probably benign	0.04
IGL00801:Zdbf2	APN	1	63303038	missense	possibly damaging	0.66
IGL02803:Zdbf2	APN	1	63303077	missense	possibly damaging	0.46
R0143:Zdbf2	UTSW	1	63308074	missense	probably benign	0.01
R0147:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0148:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0433:Zdbf2	UTSW	1	63306143	missense	possibly damaging	0.46
R0502:Zdbf2	UTSW	1	63305290	missense	possibly damaging	0.66
R0645:Zdbf2	UTSW	1	63304950	missense	possibly damaging	0.81
R1068:Zdbf2	UTSW	1	63303430	missense	possibly damaging	0.94
R1216:Zdbf2	UTSW	1	63303002	missense	possibly damaging	0.83
R1235:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R1352:Zdbf2	UTSW	1	63303053	missense	probably damaging	0.96
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1435:Zdbf2	UTSW	1	63303040	missense	possibly damaging	0.66
R1562:Zdbf2	UTSW	1	63303588	missense	possibly damaging	0.83
R1624:Zdbf2	UTSW	1	63303859	missense	possibly damaging	0.66
R1635:Zdbf2	UTSW	1	63304334	missense	possibly damaging	0.92
R1644:Zdbf2	UTSW	1	63308972	missense	possibly damaging	0.66
R1662:Zdbf2	UTSW	1	63304249	nonsense	probably null
R1700:Zdbf2	UTSW	1	63302741	missense	unknown
R1720:Zdbf2	UTSW	1	63303277	missense	possibly damaging	0.46
R1853:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1854:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1973:Zdbf2	UTSW	1	63309701	missense	unknown
R2336:Zdbf2	UTSW	1	63303464	missense	probably benign	0.00
R2428:Zdbf2	UTSW	1	63305615	missense	probably benign	0.04
R3010:Zdbf2	UTSW	1	63303065	missense	possibly damaging	0.92
R3034:Zdbf2	UTSW	1	63304205	missense	probably damaging	0.96
R3079:Zdbf2	UTSW	1	63307477	missense	probably benign	0.05
R3196:Zdbf2	UTSW	1	63308420	missense	possibly damaging	0.46
R3711:Zdbf2	UTSW	1	63308671	missense	possibly damaging	0.83
R3845:Zdbf2	UTSW	1	63308324	missense	possibly damaging	0.66
R4093:Zdbf2	UTSW	1	63309781	missense	possibly damaging	0.83
R4250:Zdbf2	UTSW	1	63302861	missense	possibly damaging	0.46
R4592:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R4721:Zdbf2	UTSW	1	63308792	missense	possibly damaging	0.46
R4779:Zdbf2	UTSW	1	63303238	missense	possibly damaging	0.66
R4928:Zdbf2	UTSW	1	63308814	missense	possibly damaging	0.81
R4943:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.92
R5025:Zdbf2	UTSW	1	63303650	missense	possibly damaging	0.82
R5095:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R5149:Zdbf2	UTSW	1	63304903	missense	possibly damaging	0.83
R5326:Zdbf2	UTSW	1	63304411	missense	possibly damaging	0.66
R5341:Zdbf2	UTSW	1	63307933	missense	probably benign	0.27
R5511:Zdbf2	UTSW	1	63305677	missense	probably benign	0.03
R5809:Zdbf2	UTSW	1	63305876	missense	possibly damaging	0.90
R5902:Zdbf2	UTSW	1	63306526	missense	possibly damaging	0.83
R6162:Zdbf2	UTSW	1	63280818	start gained	probably benign
R6245:Zdbf2	UTSW	1	63304433	missense	possibly damaging	0.46
R6332:Zdbf2	UTSW	1	63307822	missense	possibly damaging	0.66
R6361:Zdbf2	UTSW	1	63303321	missense	possibly damaging	0.66
R6489:Zdbf2	UTSW	1	63307478	missense	possibly damaging	0.46
R6517:Zdbf2	UTSW	1	63305520	missense	possibly damaging	0.81
R6624:Zdbf2	UTSW	1	63303914	missense	possibly damaging	0.46
R6643:Zdbf2	UTSW	1	63304508	missense	possibly damaging	0.82
R6786:Zdbf2	UTSW	1	63304520	missense	possibly damaging	0.46
R6808:Zdbf2	UTSW	1	63308528	missense	possibly damaging	0.66
R6896:Zdbf2	UTSW	1	63308872	missense	probably damaging	0.98
R6997:Zdbf2	UTSW	1	63290766	missense	probably benign	0.09
R7011:Zdbf2	UTSW	1	63306766	missense	possibly damaging	0.66
R7058:Zdbf2	UTSW	1	63307404	missense	possibly damaging	0.66
R7066:Zdbf2	UTSW	1	63307559	missense	probably benign
R7177:Zdbf2	UTSW	1	63294961	missense	possibly damaging	0.94
R7184:Zdbf2	UTSW	1	63306505	missense	possibly damaging	0.92
R7273:Zdbf2	UTSW	1	63303404	missense	possibly damaging	0.90
R7387:Zdbf2	UTSW	1	63304039	missense	possibly damaging	0.46
R7468:Zdbf2	UTSW	1	63307510	missense	probably benign
R7695:Zdbf2	UTSW	1	63307370	missense	possibly damaging	0.83
R7712:Zdbf2	UTSW	1	63305371	missense	possibly damaging	0.83
R7735:Zdbf2	UTSW	1	63304105	missense	possibly damaging	0.66
R7736:Zdbf2	UTSW	1	63308007	nonsense	probably null
R7759:Zdbf2	UTSW	1	63308376	missense	possibly damaging	0.46
R7796:Zdbf2	UTSW	1	63303424	missense	possibly damaging	0.90
R7908:Zdbf2	UTSW	1	63306827	missense	possibly damaging	0.46
R7970:Zdbf2	UTSW	1	63304171	missense	possibly damaging	0.92
R8076:Zdbf2	UTSW	1	63306101	missense	possibly damaging	0.92
R8152:Zdbf2	UTSW	1	63306413	missense	possibly damaging	0.92
R8195:Zdbf2	UTSW	1	63304066	missense	possibly damaging	0.83
R8272:Zdbf2	UTSW	1	63305983	missense	probably benign
R8306:Zdbf2	UTSW	1	63304075	missense	possibly damaging	0.66
R8309:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R8323:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.46
R8400:Zdbf2	UTSW	1	63304976	missense	possibly damaging	0.92
R8443:Zdbf2	UTSW	1	63306007	missense	possibly damaging	0.83
R8460:Zdbf2	UTSW	1	63309570	small deletion	probably benign
R8528:Zdbf2	UTSW	1	63303386	missense	possibly damaging	0.82
R8812:Zdbf2	UTSW	1	63308113	missense	probably benign	0.00
R8962:Zdbf2	UTSW	1	63308003	missense	probably benign	0.00
R9061:Zdbf2	UTSW	1	63307137	missense
R9072:Zdbf2	UTSW	1	63305764	missense	possibly damaging	0.83
R9232:Zdbf2	UTSW	1	63308009	missense	possibly damaging	0.66
R9257:Zdbf2	UTSW	1	63306241	missense	probably damaging	1.00
R9411:Zdbf2	UTSW	1	63304129	missense	probably damaging	0.97
R9470:Zdbf2	UTSW	1	63305625	missense	possibly damaging	0.82
R9606:Zdbf2	UTSW	1	63303377	missense	possibly damaging	0.92
R9621:Zdbf2	UTSW	1	63303476	missense	possibly damaging	0.66
RF021:Zdbf2	UTSW	1	63302652	missense	possibly damaging	0.82
X0018:Zdbf2	UTSW	1	63305351	missense	possibly damaging	0.92
X0027:Zdbf2	UTSW	1	63308007	nonsense	probably null
X0057:Zdbf2	UTSW	1	63305390	missense	possibly damaging	0.66
X0063:Zdbf2	UTSW	1	63305537	missense	probably benign	0.04
Z1176:Zdbf2	UTSW	1	63304245	missense	possibly damaging	0.83
Z1177:Zdbf2	UTSW	1	63304086	frame shift	probably null
Z1177:Zdbf2	UTSW	1	63309203	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GCTTTGAAAGAGGGCCATGCTGAC -3'
(R):5'- CTGCCTGGACTGAGAAACCAGAATC -3'

Sequencing Primer
(F):5'- GGCCATGCTGACCCAAAAG -3'
(R):5'- GGCTGTTATCTTCCAAGGACAC -3'

Posted On

2013-09-30