Incidental Mutation 'R9638:Scel'
ID 725839
Institutional Source Beutler Lab
Gene Symbol Scel
Ensembl Gene ENSMUSG00000022123
Gene Name sciellin
Synonyms 9230114I02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9638 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 103513342-103612797 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 103541973 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 127 (A127S)
Ref Sequence ENSEMBL: ENSMUSP00000093233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]
AlphaFold Q9EQG3
Predicted Effect possibly damaging
Transcript: ENSMUST00000095576
AA Change: A127S

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123
AA Change: A127S

DomainStartEndE-ValueType
low complexity region 111 131 N/A INTRINSIC
low complexity region 159 178 N/A INTRINSIC
internal_repeat_1 204 327 9.24e-7 PROSPERO
internal_repeat_1 378 505 9.24e-7 PROSPERO
low complexity region 525 537 N/A INTRINSIC
LIM 584 642 2.23e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000227322
AA Change: A127S

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T G 4: 53,092,806 E326A probably damaging Het
Aldh1a1 T A 19: 20,636,736 N423K probably benign Het
Aldh4a1 T A 4: 139,644,116 I447N probably damaging Het
Atg9b T C 5: 24,391,408 D170G possibly damaging Het
Bnc2 C T 4: 84,414,255 V75M probably damaging Het
Bnip3l G A 14: 67,008,765 P7L possibly damaging Het
Ccdc162 C A 10: 41,561,163 C1750F probably benign Het
Cdh10 T A 15: 18,964,215 N154K probably damaging Het
Cdh22 T C 2: 165,146,767 I223V probably damaging Het
Ces1b T A 8: 93,079,906 H4L probably benign Het
Cfap46 A T 7: 139,629,847 F1806I unknown Het
Cwh43 T A 5: 73,408,143 V17D possibly damaging Het
Ddx3y C T Y: 1,263,599 G623D probably benign Het
Dtna A T 18: 23,611,065 I389L probably benign Het
F830016B08Rik A G 18: 60,299,884 D13G probably benign Het
Fam160a1 T A 3: 85,661,084 N1043Y probably damaging Het
Fam161b T C 12: 84,356,413 I148V probably benign Het
Fli1 T C 9: 32,476,724 Y23C probably damaging Het
Gimap6 A G 6: 48,702,490 V204A probably benign Het
Ighv4-1 T G 12: 113,948,284 R116S probably damaging Het
Isx T C 8: 74,892,938 L239P probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Krt81 T C 15: 101,460,975 T299A probably benign Het
Lrrc30 A G 17: 67,632,231 L118P probably damaging Het
Mapk8ip3 T C 17: 24,899,049 T1290A probably benign Het
Mef2b ACCCTCACCC ACC 8: 70,166,856 probably null Het
Meltf G A 16: 31,887,591 E298K possibly damaging Het
Muc16 T A 9: 18,639,330 E5222D probably benign Het
Nin T C 12: 70,020,844 N2003S Het
Olfr124 G A 17: 37,805,618 V158M probably damaging Het
Olfr382 A G 11: 73,517,049 I50T probably benign Het
Olfr583 T C 7: 103,051,811 L171P probably damaging Het
Palld A G 8: 61,549,754 V826A unknown Het
Paxbp1 C A 16: 91,034,993 V336L probably benign Het
Paxbp1 T A 16: 91,034,994 E335D probably benign Het
Por C A 5: 135,725,761 Q12K unknown Het
Pot1a G A 6: 25,750,107 Q519* probably null Het
Psd GCC GC 19: 46,313,402 probably null Het
Ptger4 A G 15: 5,235,212 F321S probably damaging Het
Ptk7 A G 17: 46,579,593 Y438H possibly damaging Het
Rimklb A T 6: 122,456,599 N254K probably benign Het
Rpn2 A T 2: 157,283,646 T26S probably benign Het
Rtn4rl2 A T 2: 84,880,416 L168H probably damaging Het
Sema4a T A 3: 88,449,759 N302Y probably damaging Het
Supt3 A G 17: 44,923,246 T50A possibly damaging Het
Upf3a G A 8: 13,798,343 A380T probably benign Het
Zbtb14 G A 17: 69,388,380 E358K probably damaging Het
Zfp677 A T 17: 21,397,794 H371L probably damaging Het
Other mutations in Scel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Scel APN 14 103529995 missense probably benign 0.01
IGL00913:Scel APN 14 103581809 missense probably benign 0.35
IGL01086:Scel APN 14 103612391 missense probably benign 0.05
IGL01352:Scel APN 14 103533338 missense possibly damaging 0.54
IGL01396:Scel APN 14 103608094 splice site probably benign
IGL01954:Scel APN 14 103603242 splice site probably benign
IGL02064:Scel APN 14 103533326 missense probably damaging 0.98
IGL02186:Scel APN 14 103564821 missense probably benign 0.23
IGL02475:Scel APN 14 103537008 missense possibly damaging 0.95
IGL02926:Scel APN 14 103576247 nonsense probably null
IGL03122:Scel APN 14 103599406 missense possibly damaging 0.66
IGL03135:Scel APN 14 103586514 missense probably benign 0.02
PIT4585001:Scel UTSW 14 103592368 missense possibly damaging 0.90
R0346:Scel UTSW 14 103529984 missense probably damaging 1.00
R0394:Scel UTSW 14 103562518 missense probably benign 0.15
R0418:Scel UTSW 14 103603254 missense probably benign
R0635:Scel UTSW 14 103583139 critical splice donor site probably null
R0815:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0863:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0990:Scel UTSW 14 103581832 missense possibly damaging 0.55
R1084:Scel UTSW 14 103564843 critical splice donor site probably null
R1641:Scel UTSW 14 103533316 missense probably damaging 1.00
R2001:Scel UTSW 14 103610790 missense possibly damaging 0.66
R2002:Scel UTSW 14 103541985 missense probably damaging 1.00
R2341:Scel UTSW 14 103608170 missense possibly damaging 0.92
R3425:Scel UTSW 14 103608106 missense possibly damaging 0.92
R3836:Scel UTSW 14 103592386 missense possibly damaging 0.66
R4035:Scel UTSW 14 103530004 missense probably damaging 1.00
R4197:Scel UTSW 14 103599400 missense probably damaging 0.97
R4737:Scel UTSW 14 103572037 missense possibly damaging 0.79
R4801:Scel UTSW 14 103583100 missense probably benign 0.01
R4802:Scel UTSW 14 103583100 missense probably benign 0.01
R5369:Scel UTSW 14 103586493 missense probably benign 0.00
R5555:Scel UTSW 14 103602206 missense probably benign 0.27
R5582:Scel UTSW 14 103583139 critical splice donor site probably benign
R5931:Scel UTSW 14 103605624 nonsense probably null
R5978:Scel UTSW 14 103529254 splice site probably null
R6045:Scel UTSW 14 103592213 missense probably benign 0.12
R6062:Scel UTSW 14 103585136 missense possibly damaging 0.82
R6218:Scel UTSW 14 103572042 missense probably benign 0.12
R6225:Scel UTSW 14 103591984 missense probably benign 0.27
R7102:Scel UTSW 14 103543832 nonsense probably null
R7349:Scel UTSW 14 103543879 missense probably benign 0.11
R8376:Scel UTSW 14 103572015 missense probably benign 0.02
R8924:Scel UTSW 14 103592371 missense possibly damaging 0.66
R9014:Scel UTSW 14 103585139 missense probably benign
R9130:Scel UTSW 14 103533310 missense probably benign 0.05
R9135:Scel UTSW 14 103602190 missense probably benign
R9179:Scel UTSW 14 103574400 missense possibly damaging 0.79
R9614:Scel UTSW 14 103605596 missense probably damaging 1.00
R9672:Scel UTSW 14 103599402 missense possibly damaging 0.82
R9719:Scel UTSW 14 103572006 critical splice acceptor site probably null
X0026:Scel UTSW 14 103591993 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CTGTCAACCCAACATAATAATGAGGTG -3'
(R):5'- CGTAAACTCATGACCCACAGTTTC -3'

Sequencing Primer
(F):5'- TGAAGAGAATGCAAATCCATACCATG -3'
(R):5'- CAGTTTCAAAGCCCTAAGGATAC -3'
Posted On 2022-09-12