Incidental Mutation 'R9639:St18'
ID 725859
Institutional Source Beutler Lab
Gene Symbol St18
Ensembl Gene ENSMUSG00000033740
Gene Name suppression of tumorigenicity 18
Synonyms Nzf3, Myt3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9639 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 6487231-6860940 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 6859022 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 46 (I46T)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043578] [ENSMUST00000131494] [ENSMUST00000140079] [ENSMUST00000150761] [ENSMUST00000151281] [ENSMUST00000163727]
AlphaFold Q80TY4
Predicted Effect probably benign
Transcript: ENSMUST00000043578
SMART Domains Protein: ENSMUSP00000042056
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 365 392 7.8e-15 PFAM
Pfam:zf-C2HC 409 437 4.2e-17 PFAM
Pfam:MYT1 476 713 1.3e-75 PFAM
Pfam:zf-C2HC 721 749 4e-19 PFAM
Pfam:zf-C2HC 765 793 1.7e-19 PFAM
Pfam:zf-C2HC 813 841 1.1e-17 PFAM
Pfam:zf-C2HC 866 893 9.1e-15 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000131494
SMART Domains Protein: ENSMUSP00000117789
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140079
SMART Domains Protein: ENSMUSP00000118322
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150761
SMART Domains Protein: ENSMUSP00000120298
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151281
SMART Domains Protein: ENSMUSP00000122055
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163727
SMART Domains Protein: ENSMUSP00000131417
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 365 392 7.8e-15 PFAM
Pfam:zf-C2HC 409 437 4.2e-17 PFAM
Pfam:MYT1 476 713 1.3e-75 PFAM
Pfam:zf-C2HC 721 749 4e-19 PFAM
Pfam:zf-C2HC 765 793 1.7e-19 PFAM
Pfam:zf-C2HC 813 841 1.1e-17 PFAM
Pfam:zf-C2HC 866 893 9.1e-15 PFAM
coiled coil region 918 987 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,294,122 D1265G probably benign Het
Baz2b T A 2: 59,901,484 N2070I probably benign Het
Bnip3l G A 14: 67,008,765 P7L possibly damaging Het
C530008M17Rik T C 5: 76,858,150 V786A unknown Het
Chd9 A T 8: 91,034,212 E2195V probably null Het
D6Ertd527e G C 6: 87,111,857 S334T unknown Het
Ddx11 A G 17: 66,130,017 D102G Het
Egf T C 3: 129,720,300 T421A possibly damaging Het
Fbxo11 A G 17: 88,008,679 V365A Het
Gmps T A 3: 64,015,517 S634T probably damaging Het
Lrrc7 T C 3: 158,240,501 K187R probably benign Het
Lyplal1 A T 1: 186,117,212 C13* probably null Het
Mycbp2 A G 14: 103,196,381 W2255R probably damaging Het
Myo5c C A 9: 75,258,195 H428Q probably damaging Het
Nrap T C 19: 56,345,516 T1005A possibly damaging Het
Olfr1344 A T 7: 6,440,291 R130S probably benign Het
Pcdh12 C T 18: 38,268,979 M1123I probably damaging Het
Pdzrn3 A G 6: 101,169,211 S393P probably benign Het
Pgr A T 9: 8,900,993 S176C possibly damaging Het
Ppp2r3a T C 9: 101,145,514 N312S probably benign Het
Qrich2 G A 11: 116,456,098 P1300L probably benign Het
Sap130 T C 18: 31,711,736 probably null Het
Slc15a3 T A 19: 10,843,353 Y111* probably null Het
Slc26a9 A G 1: 131,750,671 E25G probably damaging Het
Slc2a3 A G 6: 122,737,240 F110L probably benign Het
Spesp1 A T 9: 62,272,956 D223E possibly damaging Het
Trmt6 T A 2: 132,808,942 K249* probably null Het
Ttll10 A T 4: 156,035,046 I632K probably benign Het
Vmn1r216 A G 13: 23,099,348 N67S probably benign Het
Vmn1r28 C T 6: 58,266,011 Q280* probably null Het
Vmn2r38 T G 7: 9,075,064 D773A probably damaging Het
Vmn2r92 A G 17: 18,152,090 Y54C probably damaging Het
Ywhae G A 11: 75,759,422 G237S probably benign Het
Zswim5 A G 4: 116,979,517 E666G probably damaging Het
Other mutations in St18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:St18 APN 1 6802572 missense probably benign 0.07
IGL00840:St18 APN 1 6833594 missense probably damaging 1.00
IGL01016:St18 APN 1 6844323 missense probably damaging 0.98
IGL01116:St18 APN 1 6802632 missense probably damaging 0.96
IGL01719:St18 APN 1 6845796 splice site probably benign
IGL01885:St18 APN 1 6844372 critical splice donor site probably null
IGL02486:St18 APN 1 6820083 missense probably damaging 1.00
IGL02611:St18 APN 1 6768890 splice site probably benign
IGL02742:St18 APN 1 6802316 splice site probably benign
IGL02953:St18 APN 1 6844113 splice site probably benign
IGL02999:St18 APN 1 6817605 missense probably benign 0.01
IGL03092:St18 APN 1 6768894 splice site probably benign
Smallish UTSW 1 6855473 critical splice donor site probably null
IGL03055:St18 UTSW 1 6802735 missense probably damaging 0.99
R0089:St18 UTSW 1 6848948 missense probably benign 0.02
R0257:St18 UTSW 1 6819962 missense probably benign 0.04
R0383:St18 UTSW 1 6803024 missense probably damaging 1.00
R0588:St18 UTSW 1 6817738 missense probably damaging 0.99
R0989:St18 UTSW 1 6827881 missense probably benign 0.04
R1068:St18 UTSW 1 6795562 missense probably benign 0.01
R1311:St18 UTSW 1 6845644 missense probably damaging 1.00
R1530:St18 UTSW 1 6845569 critical splice acceptor site probably null
R1723:St18 UTSW 1 6810685 splice site probably benign
R1926:St18 UTSW 1 6802689 missense probably benign 0.00
R1927:St18 UTSW 1 6802712 missense probably benign 0.00
R2035:St18 UTSW 1 6802328 missense probably benign 0.00
R2091:St18 UTSW 1 6827971 missense probably benign 0.08
R2139:St18 UTSW 1 6810615 missense possibly damaging 0.85
R2261:St18 UTSW 1 6845572 missense probably damaging 0.96
R2300:St18 UTSW 1 6855402 missense probably damaging 1.00
R2322:St18 UTSW 1 6844124 nonsense probably null
R2846:St18 UTSW 1 6845587 missense probably damaging 0.96
R3738:St18 UTSW 1 6855473 critical splice donor site probably null
R3739:St18 UTSW 1 6855473 critical splice donor site probably null
R3772:St18 UTSW 1 6844329 missense probably damaging 1.00
R3805:St18 UTSW 1 6802353 missense probably damaging 1.00
R3953:St18 UTSW 1 6802893 missense probably damaging 0.99
R4034:St18 UTSW 1 6855473 critical splice donor site probably null
R4036:St18 UTSW 1 6827786 missense probably damaging 1.00
R4407:St18 UTSW 1 6827837 missense probably benign 0.29
R4527:St18 UTSW 1 6855423 missense probably damaging 1.00
R4740:St18 UTSW 1 6817604 missense probably benign
R4838:St18 UTSW 1 6802905 missense probably benign 0.01
R5182:St18 UTSW 1 6817653 missense probably benign 0.03
R5186:St18 UTSW 1 6802317 splice site probably null
R5354:St18 UTSW 1 6844171 missense probably damaging 1.00
R5423:St18 UTSW 1 6802616 missense possibly damaging 0.91
R5724:St18 UTSW 1 6770950 missense probably benign 0.13
R6182:St18 UTSW 1 6844118 splice site probably null
R6491:St18 UTSW 1 6827985 nonsense probably null
R6503:St18 UTSW 1 6795397 missense probably damaging 1.00
R7037:St18 UTSW 1 6803036 missense possibly damaging 0.65
R7098:St18 UTSW 1 6827842 missense probably damaging 1.00
R7132:St18 UTSW 1 6859127 missense
R7144:St18 UTSW 1 6833594 missense probably damaging 1.00
R7150:St18 UTSW 1 6803019 missense probably damaging 1.00
R7334:St18 UTSW 1 6802559 missense probably benign 0.00
R7502:St18 UTSW 1 6827970 missense probably benign 0.09
R7729:St18 UTSW 1 6802537 missense probably benign 0.00
R7848:St18 UTSW 1 6857445 critical splice donor site probably null
R8088:St18 UTSW 1 6828005 missense probably benign 0.00
R8299:St18 UTSW 1 6802992 missense probably benign 0.01
R8338:St18 UTSW 1 6809292 missense probably damaging 1.00
R8690:St18 UTSW 1 6802564 missense probably benign
R8753:St18 UTSW 1 6845791 missense probably damaging 1.00
R8808:St18 UTSW 1 6810602 missense probably damaging 1.00
R8880:St18 UTSW 1 6795395 nonsense probably null
R9055:St18 UTSW 1 6802982 nonsense probably null
R9292:St18 UTSW 1 6827882 missense probably benign 0.32
R9322:St18 UTSW 1 6795523 missense probably benign 0.00
R9530:St18 UTSW 1 6802773 missense probably benign 0.00
R9603:St18 UTSW 1 6845587 missense probably damaging 1.00
R9611:St18 UTSW 1 6802923 missense probably benign 0.00
R9644:St18 UTSW 1 6859052 missense
R9740:St18 UTSW 1 6803063 nonsense probably null
R9750:St18 UTSW 1 6802992 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCTGCAGGGGCCTAATACC -3'
(R):5'- CTAGTGGGCGCCATTTATCTTC -3'

Sequencing Primer
(F):5'- TTTTCCCCAGCTGACATAAAAAGG -3'
(R):5'- AGTGGGCGCCATTTATCTTCATAATC -3'
Posted On 2022-09-12