Mutagenetix > Incidental Mutation

Incidental Mutation 'R9640:A830018L16Rik'

725894

Institutional Source

Beutler Lab

Gene Symbol

A830018L16Rik

Ensembl Gene

ENSMUSG00000057715

Gene Name

RIKEN cDNA A830018L16 gene

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.056) question?

Stock #

R9640 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

11414105-11975901 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 11950976 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 403 (K403R)

Ref Sequence

ENSEMBL: ENSMUSP00000117421 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048613] [ENSMUST00000137824] [ENSMUST00000179089]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000048613
AA Change: K400R

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000043857
Gene: ENSMUSG00000057715
AA Change: K400R

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC
low complexity region	233	248	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000137824
AA Change: K403R

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000117421
Gene: ENSMUSG00000057715
AA Change: K403R

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC
low complexity region	233	248	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000179089
AA Change: K387R

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to the cyclic AMP dependent protein kinase regulators. Naturally occurring mutations in this gene are associated with an increased risk for severe toxicities, such as diarrhea and neutropenia, in patients undergoing chemotherapeutic treatment. [provided by RefSeq, Mar 2017]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530077C05Rik	A	T	9: 22,439,932	I457L	possibly damaging	Het
A630010A05Rik	T	C	16: 14,618,725	V214A		Het
Abhd17c	A	T	7: 84,151,606	L80Q	probably damaging	Het
Adam30	T	A	3: 98,162,304	D484E	probably damaging	Het
Aspm	T	A	1: 139,480,272	V2299E	possibly damaging	Het
Atp6v1c1	C	T	15: 38,689,137	R281W	probably damaging	Het
Bclaf1	T	C	10: 20,325,807		probably null	Het
Ccdc50	T	C	16: 27,406,711	V58A	probably damaging	Het
Cep162	A	G	9: 87,244,299	S187P	probably benign	Het
Clip4	C	T	17: 71,856,269	T612M	possibly damaging	Het
Corin	C	T	5: 72,435,254	V267I	probably benign	Het
Cyp2c37	T	A	19: 40,011,736	I434K	probably benign	Het
Ddx43	T	G	9: 78,396,107	D76E	probably benign	Het
Dusp5	A	G	19: 53,537,620	E231G	probably damaging	Het
Fam114a1	G	A	5: 65,009,051	V242I	probably damaging	Het
Frem1	T	A	4: 82,913,659	R1973S	probably benign	Het
Gas2l3	A	T	10: 89,430,912	D55E	probably damaging	Het
Gm436	T	A	4: 144,686,239	R44W	possibly damaging	Het
Grwd1	T	C	7: 45,827,879	I195V	probably benign	Het
H2-M1	G	T	17: 36,672,139	T20K	probably benign	Het
H2-Q2	T	G	17: 35,343,230	L151R	probably damaging	Het
Hbegf	T	C	18: 36,507,590	Y138C	probably damaging	Het
Hectd1	C	A	12: 51,748,414	E2411*	probably null	Het
Igkv11-125	T	A	6: 67,913,799	S34T	possibly damaging	Het
Jam2	A	T	16: 84,813,072	T191S	probably benign	Het
Kcnh8	T	C	17: 52,878,061	I457T	probably damaging	Het
Khk	A	G	5: 30,921,959	D15G	probably damaging	Het
Lrba	T	A	3: 86,619,568	Y2244*	probably null	Het
Lrp1b	T	C	2: 41,188,917	N1841S		Het
Lrp4	A	G	2: 91,485,951	T805A	probably benign	Het
Lrp6	C	T	6: 134,464,451	R1184Q	probably damaging	Het
Map3k1	A	T	13: 111,764,165	L442*	probably null	Het
Mapk8ip3	T	C	17: 24,936,673	N61S	possibly damaging	Het
Mdn1	T	A	4: 32,754,539	V4685E	probably damaging	Het
Mib2	T	C	4: 155,660,868	E134G	possibly damaging	Het
Mtss1l	T	C	8: 110,737,943	V403A	probably benign	Het
Ndst4	C	A	3: 125,438,547	T255K	probably damaging	Het
Olfr1357	G	C	10: 78,612,477	L55V	probably damaging	Het
Olfr166	A	T	16: 19,487,011	M58L	probably damaging	Het
Olfr291	G	A	7: 84,856,906	C181Y	probably damaging	Het
Olfr44	A	G	9: 39,485,100	L51P	probably damaging	Het
Pak1	T	A	7: 97,866,148	D126E	probably benign	Het
Rgl1	T	C	1: 152,521,391	T675A	probably damaging	Het
Rgs1	T	C	1: 144,245,378	D185G	probably damaging	Het
Rnase2a	G	A	14: 51,255,660	R83C	probably damaging	Het
Sfmbt2	A	G	2: 10,579,183	T784A	probably damaging	Het
Slc6a21	A	T	7: 45,287,765	T272S		Het
Sorcs2	G	T	5: 36,065,421	S330*	probably null	Het
Spdef	G	T	17: 27,717,209	H253Q		Het
Tas2r144	A	G	6: 42,215,494	E56G	probably benign	Het
Trim66	A	G	7: 109,475,618	C479R	probably damaging	Het
Ttc36	A	T	9: 44,802,737	L28Q	probably benign	Het
Ugt1a5	T	C	1: 88,166,376	S109P	possibly damaging	Het
Vamp5	G	A	6: 72,370,293		probably benign	Het
Wwox	A	G	8: 114,439,800	D10G	possibly damaging	Het
Zfp40	T	C	17: 23,175,519	Y698C	probably damaging	Het
Zfp62	A	G	11: 49,215,631	D183G	probably benign	Het
Zfp932	T	C	5: 110,009,198	V254A	probably benign	Het
Zfp943	T	A	17: 21,990,918	L57H	probably damaging	Het

Other mutations in A830018L16Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:A830018L16Rik	APN	1	11748054	missense	probably damaging	0.98
IGL01916:A830018L16Rik	APN	1	11748107	splice site	probably benign
IGL02040:A830018L16Rik	APN	1	11933598	intron	probably benign
IGL02432:A830018L16Rik	APN	1	11748079	missense	probably damaging	1.00
IGL02693:A830018L16Rik	APN	1	11596282	missense	probably damaging	1.00
IGL02736:A830018L16Rik	APN	1	11972051	missense	probably benign	0.02
IGL03293:A830018L16Rik	APN	1	11545151	splice site	probably null
IGL02835:A830018L16Rik	UTSW	1	11972055	missense	possibly damaging	0.54
R1203:A830018L16Rik	UTSW	1	11518594	missense	probably damaging	1.00
R1216:A830018L16Rik	UTSW	1	11798492	missense	probably damaging	0.99
R1548:A830018L16Rik	UTSW	1	11518594	missense	probably damaging	1.00
R1644:A830018L16Rik	UTSW	1	11414590	nonsense	probably null
R1855:A830018L16Rik	UTSW	1	11747971	missense	probably damaging	1.00
R1858:A830018L16Rik	UTSW	1	11974953	missense	unknown
R2265:A830018L16Rik	UTSW	1	11972104	critical splice donor site	probably null
R2296:A830018L16Rik	UTSW	1	11512051	missense	possibly damaging	0.94
R2484:A830018L16Rik	UTSW	1	11596302	missense	probably damaging	1.00
R3730:A830018L16Rik	UTSW	1	11545226	missense	probably damaging	1.00
R3752:A830018L16Rik	UTSW	1	11518680	missense	probably damaging	1.00
R3861:A830018L16Rik	UTSW	1	11588554	splice site	probably benign
R4305:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4306:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4307:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4558:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4598:A830018L16Rik	UTSW	1	11747964	critical splice acceptor site	probably null
R4652:A830018L16Rik	UTSW	1	11537342	intron	probably benign
R5492:A830018L16Rik	UTSW	1	11545207	missense	probably damaging	0.99
R5493:A830018L16Rik	UTSW	1	11545207	missense	probably damaging	0.99
R5802:A830018L16Rik	UTSW	1	11950964	missense	probably damaging	1.00
R6007:A830018L16Rik	UTSW	1	11511916	critical splice acceptor site	probably null
R6082:A830018L16Rik	UTSW	1	11798528	missense	probably benign	0.04
R6376:A830018L16Rik	UTSW	1	11798494	missense	probably damaging	0.98
R6453:A830018L16Rik	UTSW	1	11798558	missense	possibly damaging	0.91
R6757:A830018L16Rik	UTSW	1	11596334	makesense	probably null
R6833:A830018L16Rik	UTSW	1	11588509	missense	probably damaging	1.00
R7163:A830018L16Rik	UTSW	1	11414624	missense	probably damaging	0.96
R7272:A830018L16Rik	UTSW	1	11588471	missense	probably damaging	0.97
R7566:A830018L16Rik	UTSW	1	11951028	missense	probably damaging	1.00
R7665:A830018L16Rik	UTSW	1	11972099	missense	probably damaging	0.96
R8004:A830018L16Rik	UTSW	1	11951062	splice site	probably benign
R8754:A830018L16Rik	UTSW	1	11545248	missense	probably benign	0.33
R8944:A830018L16Rik	UTSW	1	11414482	unclassified	probably benign
R8993:A830018L16Rik	UTSW	1	11545267	nonsense	probably null
R8997:A830018L16Rik	UTSW	1	11545267	nonsense	probably null
R9098:A830018L16Rik	UTSW	1	11562987	missense	probably damaging	1.00
R9704:A830018L16Rik	UTSW	1	11518689	missense	probably damaging	1.00
R9705:A830018L16Rik	UTSW	1	11518689	missense	probably damaging	1.00
Z1176:A830018L16Rik	UTSW	1	11518625	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AGTGGAGAACTACCCTTGGC -3'
(R):5'- AGCTGGACATTCCTTCGTTGTTATC -3'

Sequencing Primer
(F):5'- TGGAGAACTACCCTTGGCACATG -3'
(R):5'- AGTTAGCTTATCAACCTCTCTATGAC -3'

Posted On

2022-09-12