Incidental Mutation 'R9640:Rgs1'
ID 725897
Institutional Source Beutler Lab
Gene Symbol Rgs1
Ensembl Gene ENSMUSG00000026358
Gene Name regulator of G-protein signaling 1
Synonyms BL34
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # R9640 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 144242296-144249242 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 144245378 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 185 (D185G)
Ref Sequence ENSEMBL: ENSMUSP00000140624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167317] [ENSMUST00000169409] [ENSMUST00000172388] [ENSMUST00000185714] [ENSMUST00000189061]
AlphaFold Q9JL25
Predicted Effect probably benign
Transcript: ENSMUST00000167317
Predicted Effect probably benign
Transcript: ENSMUST00000167812
Predicted Effect probably benign
Transcript: ENSMUST00000169409
Predicted Effect probably benign
Transcript: ENSMUST00000172388
SMART Domains Protein: ENSMUSP00000130339
Gene: ENSMUSG00000026358

DomainStartEndE-ValueType
RGS 85 200 5.59e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185714
SMART Domains Protein: ENSMUSP00000140902
Gene: ENSMUSG00000026358

DomainStartEndE-ValueType
RGS 58 128 2.8e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189061
AA Change: D185G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140624
Gene: ENSMUSG00000026358
AA Change: D185G

DomainStartEndE-ValueType
RGS 85 200 5.59e-49 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulator of G-protein signalling family. This protein is located on the cytosolic side of the plasma membrane and contains a conserved, 120 amino acid motif called the RGS domain. The protein attenuates the signalling activity of G-proteins by binding to activated, GTP-bound G alpha subunits and acting as a GTPase activating protein (GAP), increasing the rate of conversion of the GTP to GDP. This hydrolysis allows the G alpha subunits to bind G beta/gamma subunit heterodimers, forming inactive G-protein heterotrimers, thereby terminating the signal. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display increased splenic B cell germinal centers, increased chemotactic responses in B cells and immature dendritic cells, and decreased antibody secreting cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A T 9: 22,439,932 I457L possibly damaging Het
A630010A05Rik T C 16: 14,618,725 V214A Het
A830018L16Rik A G 1: 11,950,976 K403R probably damaging Het
Abhd17c A T 7: 84,151,606 L80Q probably damaging Het
Adam30 T A 3: 98,162,304 D484E probably damaging Het
Aspm T A 1: 139,480,272 V2299E possibly damaging Het
Atp6v1c1 C T 15: 38,689,137 R281W probably damaging Het
Bclaf1 T C 10: 20,325,807 probably null Het
Ccdc50 T C 16: 27,406,711 V58A probably damaging Het
Cep162 A G 9: 87,244,299 S187P probably benign Het
Clip4 C T 17: 71,856,269 T612M possibly damaging Het
Corin C T 5: 72,435,254 V267I probably benign Het
Cyp2c37 T A 19: 40,011,736 I434K probably benign Het
Ddx43 T G 9: 78,396,107 D76E probably benign Het
Dusp5 A G 19: 53,537,620 E231G probably damaging Het
Fam114a1 G A 5: 65,009,051 V242I probably damaging Het
Frem1 T A 4: 82,913,659 R1973S probably benign Het
Gas2l3 A T 10: 89,430,912 D55E probably damaging Het
Gm436 T A 4: 144,686,239 R44W possibly damaging Het
Grwd1 T C 7: 45,827,879 I195V probably benign Het
H2-M1 G T 17: 36,672,139 T20K probably benign Het
H2-Q2 T G 17: 35,343,230 L151R probably damaging Het
Hbegf T C 18: 36,507,590 Y138C probably damaging Het
Hectd1 C A 12: 51,748,414 E2411* probably null Het
Igkv11-125 T A 6: 67,913,799 S34T possibly damaging Het
Jam2 A T 16: 84,813,072 T191S probably benign Het
Kcnh8 T C 17: 52,878,061 I457T probably damaging Het
Khk A G 5: 30,921,959 D15G probably damaging Het
Lrba T A 3: 86,619,568 Y2244* probably null Het
Lrp1b T C 2: 41,188,917 N1841S Het
Lrp4 A G 2: 91,485,951 T805A probably benign Het
Lrp6 C T 6: 134,464,451 R1184Q probably damaging Het
Map3k1 A T 13: 111,764,165 L442* probably null Het
Mapk8ip3 T C 17: 24,936,673 N61S possibly damaging Het
Mdn1 T A 4: 32,754,539 V4685E probably damaging Het
Mib2 T C 4: 155,660,868 E134G possibly damaging Het
Mtss1l T C 8: 110,737,943 V403A probably benign Het
Ndst4 C A 3: 125,438,547 T255K probably damaging Het
Olfr1357 G C 10: 78,612,477 L55V probably damaging Het
Olfr166 A T 16: 19,487,011 M58L probably damaging Het
Olfr291 G A 7: 84,856,906 C181Y probably damaging Het
Olfr44 A G 9: 39,485,100 L51P probably damaging Het
Pak1 T A 7: 97,866,148 D126E probably benign Het
Rgl1 T C 1: 152,521,391 T675A probably damaging Het
Rnase2a G A 14: 51,255,660 R83C probably damaging Het
Sfmbt2 A G 2: 10,579,183 T784A probably damaging Het
Slc6a21 A T 7: 45,287,765 T272S Het
Sorcs2 G T 5: 36,065,421 S330* probably null Het
Spdef G T 17: 27,717,209 H253Q Het
Tas2r144 A G 6: 42,215,494 E56G probably benign Het
Trim66 A G 7: 109,475,618 C479R probably damaging Het
Ttc36 A T 9: 44,802,737 L28Q probably benign Het
Ugt1a5 T C 1: 88,166,376 S109P possibly damaging Het
Vamp5 G A 6: 72,370,293 probably benign Het
Wwox A G 8: 114,439,800 D10G possibly damaging Het
Zfp40 T C 17: 23,175,519 Y698C probably damaging Het
Zfp62 A G 11: 49,215,631 D183G probably benign Het
Zfp932 T C 5: 110,009,198 V254A probably benign Het
Zfp943 T A 17: 21,990,918 L57H probably damaging Het
Other mutations in Rgs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Rgs1 APN 1 144245378 missense probably damaging 1.00
R0106:Rgs1 UTSW 1 144248549 missense probably benign 0.31
R0106:Rgs1 UTSW 1 144248549 missense probably benign 0.31
R0149:Rgs1 UTSW 1 144249087 start gained probably benign
R0295:Rgs1 UTSW 1 144245486 missense probably damaging 1.00
R0833:Rgs1 UTSW 1 144247933 missense probably damaging 1.00
R0836:Rgs1 UTSW 1 144247933 missense probably damaging 1.00
R1585:Rgs1 UTSW 1 144245489 critical splice acceptor site probably null
R4373:Rgs1 UTSW 1 144247906 missense probably benign 0.00
R4375:Rgs1 UTSW 1 144247906 missense probably benign 0.00
R4769:Rgs1 UTSW 1 144247929 missense probably damaging 1.00
R4961:Rgs1 UTSW 1 144248571 splice site probably null
R4992:Rgs1 UTSW 1 144246322 missense probably damaging 1.00
R5427:Rgs1 UTSW 1 144246280 nonsense probably null
R5614:Rgs1 UTSW 1 144246257 missense probably benign 0.18
R5743:Rgs1 UTSW 1 144245372 missense probably damaging 1.00
R7315:Rgs1 UTSW 1 144248899 critical splice donor site probably null
R7491:Rgs1 UTSW 1 144245396 missense probably damaging 1.00
R7633:Rgs1 UTSW 1 144248477 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTCATCTGTACTTCCACTGGGC -3'
(R):5'- ACTGGCTTAGAACACCAATTCAG -3'

Sequencing Primer
(F):5'- CTCCTGAGCCACCCAAGTAGG -3'
(R):5'- ACCATTTTAAGATGATTCTGGAACAC -3'
Posted On 2022-09-12