Incidental Mutation 'R9640:Rgs1'
ID 725897
Institutional Source Beutler Lab
Gene Symbol Rgs1
Ensembl Gene ENSMUSG00000026358
Gene Name regulator of G-protein signaling 1
Synonyms BL34
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.115) question?
Stock # R9640 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 144120407-144124862 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 144121116 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 185 (D185G)
Ref Sequence ENSEMBL: ENSMUSP00000140624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167317] [ENSMUST00000169409] [ENSMUST00000172388] [ENSMUST00000185714] [ENSMUST00000189061]
AlphaFold Q9JL25
Predicted Effect probably benign
Transcript: ENSMUST00000167317
Predicted Effect probably benign
Transcript: ENSMUST00000167812
Predicted Effect probably benign
Transcript: ENSMUST00000169409
Predicted Effect probably benign
Transcript: ENSMUST00000172388
SMART Domains Protein: ENSMUSP00000130339
Gene: ENSMUSG00000026358

DomainStartEndE-ValueType
RGS 85 200 5.59e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185714
SMART Domains Protein: ENSMUSP00000140902
Gene: ENSMUSG00000026358

DomainStartEndE-ValueType
RGS 58 128 2.8e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189061
AA Change: D185G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140624
Gene: ENSMUSG00000026358
AA Change: D185G

DomainStartEndE-ValueType
RGS 85 200 5.59e-49 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulator of G-protein signalling family. This protein is located on the cytosolic side of the plasma membrane and contains a conserved, 120 amino acid motif called the RGS domain. The protein attenuates the signalling activity of G-proteins by binding to activated, GTP-bound G alpha subunits and acting as a GTPase activating protein (GAP), increasing the rate of conversion of the GTP to GDP. This hydrolysis allows the G alpha subunits to bind G beta/gamma subunit heterodimers, forming inactive G-protein heterotrimers, thereby terminating the signal. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display increased splenic B cell germinal centers, increased chemotactic responses in B cells and immature dendritic cells, and decreased antibody secreting cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T C 16: 14,436,589 (GRCm39) V214A Het
A830018L16Rik A G 1: 12,021,200 (GRCm39) K403R probably damaging Het
Aadacl4fm4 T A 4: 144,412,809 (GRCm39) R44W possibly damaging Het
Abhd17c A T 7: 83,800,814 (GRCm39) L80Q probably damaging Het
Adam30 T A 3: 98,069,620 (GRCm39) D484E probably damaging Het
Aspm T A 1: 139,408,010 (GRCm39) V2299E possibly damaging Het
Atp6v1c1 C T 15: 38,689,381 (GRCm39) R281W probably damaging Het
Bclaf1 T C 10: 20,201,553 (GRCm39) probably null Het
Ccdc50 T C 16: 27,225,461 (GRCm39) V58A probably damaging Het
Cep162 A G 9: 87,126,352 (GRCm39) S187P probably benign Het
Clip4 C T 17: 72,163,264 (GRCm39) T612M possibly damaging Het
Corin C T 5: 72,592,597 (GRCm39) V267I probably benign Het
Cyp2c37 T A 19: 40,000,180 (GRCm39) I434K probably benign Het
Ddx43 T G 9: 78,303,389 (GRCm39) D76E probably benign Het
Dusp5 A G 19: 53,526,051 (GRCm39) E231G probably damaging Het
Fam114a1 G A 5: 65,166,394 (GRCm39) V242I probably damaging Het
Frem1 T A 4: 82,831,896 (GRCm39) R1973S probably benign Het
Gas2l3 A T 10: 89,266,774 (GRCm39) D55E probably damaging Het
Grwd1 T C 7: 45,477,303 (GRCm39) I195V probably benign Het
H2-M1 G T 17: 36,983,031 (GRCm39) T20K probably benign Het
H2-Q2 T G 17: 35,562,206 (GRCm39) L151R probably damaging Het
Hbegf T C 18: 36,640,643 (GRCm39) Y138C probably damaging Het
Hectd1 C A 12: 51,795,197 (GRCm39) E2411* probably null Het
Igkv11-125 T A 6: 67,890,783 (GRCm39) S34T possibly damaging Het
Jam2 A T 16: 84,609,960 (GRCm39) T191S probably benign Het
Kcnh8 T C 17: 53,185,089 (GRCm39) I457T probably damaging Het
Khk A G 5: 31,079,303 (GRCm39) D15G probably damaging Het
Lrba T A 3: 86,526,875 (GRCm39) Y2244* probably null Het
Lrp1b T C 2: 41,078,929 (GRCm39) N1841S Het
Lrp4 A G 2: 91,316,296 (GRCm39) T805A probably benign Het
Lrp6 C T 6: 134,441,414 (GRCm39) R1184Q probably damaging Het
Map3k1 A T 13: 111,900,699 (GRCm39) L442* probably null Het
Mapk8ip3 T C 17: 25,155,647 (GRCm39) N61S possibly damaging Het
Matcap2 A T 9: 22,351,228 (GRCm39) I457L possibly damaging Het
Mdn1 T A 4: 32,754,539 (GRCm39) V4685E probably damaging Het
Mib2 T C 4: 155,745,325 (GRCm39) E134G possibly damaging Het
Mtss2 T C 8: 111,464,575 (GRCm39) V403A probably benign Het
Ndst4 C A 3: 125,232,196 (GRCm39) T255K probably damaging Het
Or1i2 G C 10: 78,448,311 (GRCm39) L55V probably damaging Het
Or2l13 A T 16: 19,305,761 (GRCm39) M58L probably damaging Het
Or5ae2 G A 7: 84,506,114 (GRCm39) C181Y probably damaging Het
Or8g20 A G 9: 39,396,396 (GRCm39) L51P probably damaging Het
Pak1 T A 7: 97,515,355 (GRCm39) D126E probably benign Het
Rgl1 T C 1: 152,397,142 (GRCm39) T675A probably damaging Het
Rnase2a G A 14: 51,493,117 (GRCm39) R83C probably damaging Het
Sfmbt2 A G 2: 10,583,994 (GRCm39) T784A probably damaging Het
Slc6a21 A T 7: 44,937,189 (GRCm39) T272S Het
Sorcs2 G T 5: 36,222,765 (GRCm39) S330* probably null Het
Spdef G T 17: 27,936,183 (GRCm39) H253Q Het
Tas2r144 A G 6: 42,192,428 (GRCm39) E56G probably benign Het
Trim66 A G 7: 109,074,825 (GRCm39) C479R probably damaging Het
Ttc36 A T 9: 44,714,034 (GRCm39) L28Q probably benign Het
Ugt1a5 T C 1: 88,094,098 (GRCm39) S109P possibly damaging Het
Vamp5 G A 6: 72,347,276 (GRCm39) probably benign Het
Wwox A G 8: 115,166,540 (GRCm39) D10G possibly damaging Het
Zfp40 T C 17: 23,394,493 (GRCm39) Y698C probably damaging Het
Zfp62 A G 11: 49,106,458 (GRCm39) D183G probably benign Het
Zfp932 T C 5: 110,157,064 (GRCm39) V254A probably benign Het
Zfp943 T A 17: 22,209,899 (GRCm39) L57H probably damaging Het
Other mutations in Rgs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Rgs1 APN 1 144,121,116 (GRCm39) missense probably damaging 1.00
R0106:Rgs1 UTSW 1 144,124,287 (GRCm39) missense probably benign 0.31
R0106:Rgs1 UTSW 1 144,124,287 (GRCm39) missense probably benign 0.31
R0149:Rgs1 UTSW 1 144,124,825 (GRCm39) start gained probably benign
R0295:Rgs1 UTSW 1 144,121,224 (GRCm39) missense probably damaging 1.00
R0833:Rgs1 UTSW 1 144,123,671 (GRCm39) missense probably damaging 1.00
R0836:Rgs1 UTSW 1 144,123,671 (GRCm39) missense probably damaging 1.00
R1585:Rgs1 UTSW 1 144,121,227 (GRCm39) critical splice acceptor site probably null
R4373:Rgs1 UTSW 1 144,123,644 (GRCm39) missense probably benign 0.00
R4375:Rgs1 UTSW 1 144,123,644 (GRCm39) missense probably benign 0.00
R4769:Rgs1 UTSW 1 144,123,667 (GRCm39) missense probably damaging 1.00
R4961:Rgs1 UTSW 1 144,124,309 (GRCm39) splice site probably null
R4992:Rgs1 UTSW 1 144,122,060 (GRCm39) missense probably damaging 1.00
R5427:Rgs1 UTSW 1 144,122,018 (GRCm39) nonsense probably null
R5614:Rgs1 UTSW 1 144,121,995 (GRCm39) missense probably benign 0.18
R5743:Rgs1 UTSW 1 144,121,110 (GRCm39) missense probably damaging 1.00
R7315:Rgs1 UTSW 1 144,124,637 (GRCm39) critical splice donor site probably null
R7491:Rgs1 UTSW 1 144,121,134 (GRCm39) missense probably damaging 1.00
R7633:Rgs1 UTSW 1 144,124,215 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTCATCTGTACTTCCACTGGGC -3'
(R):5'- ACTGGCTTAGAACACCAATTCAG -3'

Sequencing Primer
(F):5'- CTCCTGAGCCACCCAAGTAGG -3'
(R):5'- ACCATTTTAAGATGATTCTGGAACAC -3'
Posted On 2022-09-12