Incidental Mutation 'R0765:Arhgef38'
ID 72596
Institutional Source Beutler Lab
Gene Symbol Arhgef38
Ensembl Gene ENSMUSG00000040969
Gene Name Rho guanine nucleotide exchange factor (GEF) 38
Synonyms D630013G24Rik, 9130221D24Rik
MMRRC Submission 038945-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0765 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 133112278-133234949 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 133116583 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 724 (E724K)
Ref Sequence ENSEMBL: ENSMUSP00000114238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054105] [ENSMUST00000147041]
AlphaFold Q80VK6
Predicted Effect probably damaging
Transcript: ENSMUST00000054105
AA Change: E141K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054558
Gene: ENSMUSG00000040969
AA Change: E141K

DomainStartEndE-ValueType
SH3 1 60 5.56e-1 SMART
low complexity region 95 106 N/A INTRINSIC
SH3 126 189 8.2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000147041
AA Change: E724K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114238
Gene: ENSMUSG00000040969
AA Change: E724K

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
RhoGEF 98 284 2.72e-33 SMART
low complexity region 296 312 N/A INTRINSIC
BAR 315 514 4.8e-29 SMART
SH3 584 643 5.56e-1 SMART
low complexity region 678 689 N/A INTRINSIC
SH3 709 768 1.95e-10 SMART
Meta Mutation Damage Score 0.6395 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.7%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T A 5: 107,506,934 D354E probably benign Het
Abhd16a T A 17: 35,101,851 V425D probably benign Het
Ano9 T G 7: 141,107,184 I381L probably damaging Het
Apob C T 12: 8,016,518 L4496F probably benign Het
Atp8b4 T A 2: 126,372,150 probably null Het
Baiap2l1 G T 5: 144,277,703 P394T probably damaging Het
Cnbp C A 6: 87,845,173 C122F probably damaging Het
Col3a1 A G 1: 45,336,651 probably benign Het
Colq T G 14: 31,526,037 D408A possibly damaging Het
Cuzd1 A T 7: 131,316,095 S259T probably benign Het
Cyp3a57 A G 5: 145,390,410 probably benign Het
Dbn1 C A 13: 55,482,294 V112F probably damaging Het
Dcc T A 18: 71,362,990 D1028V probably damaging Het
Dnajb11 T C 16: 22,862,568 V32A probably damaging Het
Dsg4 G A 18: 20,454,646 probably benign Het
Dyrk1b C T 7: 28,185,711 probably benign Het
Ebf1 T A 11: 44,869,160 M208K probably damaging Het
Efhc1 A G 1: 20,978,652 I430V probably benign Het
Elovl2 T C 13: 41,187,466 Y181C probably benign Het
Fras1 A G 5: 96,552,796 Q225R probably benign Het
Frmd3 G A 4: 74,161,767 R332Q probably damaging Het
Glg1 A G 8: 111,159,797 probably null Het
Hmcn1 G A 1: 150,808,787 T344M probably damaging Het
Il1rap T G 16: 26,710,632 probably null Het
Klra1 A T 6: 130,379,092 probably benign Het
Larp7 C A 3: 127,546,165 K289N probably damaging Het
Lgr6 C A 1: 134,993,886 G240V probably benign Het
Lrp10 G T 14: 54,468,090 D246Y probably damaging Het
Map3k20 G A 2: 72,371,925 V167I probably damaging Het
Med23 T C 10: 24,900,710 S347P probably damaging Het
Mybph T C 1: 134,197,496 V254A possibly damaging Het
Ndufv2 A G 17: 66,101,078 probably benign Het
Nuf2 A T 1: 169,522,936 probably benign Het
Nup210l T C 3: 90,119,877 Y189H probably damaging Het
Olfr1025-ps1 T C 2: 85,918,705 L260P probably damaging Het
Olfr1263 G A 2: 90,015,670 V247I probably benign Het
Olfr574 C T 7: 102,948,732 T79I probably damaging Het
Pdgfra C A 5: 75,187,987 probably benign Het
Phlpp1 T C 1: 106,392,283 L1336P probably damaging Het
Prpf38b T C 3: 108,911,418 T9A possibly damaging Het
Rnf213 G A 11: 119,423,095 probably null Het
Saal1 A T 7: 46,699,647 V281E possibly damaging Het
Slc17a3 C T 13: 23,846,896 Q186* probably null Het
Slc6a2 A G 8: 92,989,031 T266A probably damaging Het
Snai2 T C 16: 14,706,804 V58A possibly damaging Het
Srfbp1 T C 18: 52,490,435 probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tesk1 C T 4: 43,446,706 P365S possibly damaging Het
Tmem127 C A 2: 127,257,149 T201K probably damaging Het
Trim17 T G 11: 58,971,369 V409G possibly damaging Het
Trim43c C T 9: 88,841,916 T165I probably benign Het
Ush2a C A 1: 188,948,574 F4916L possibly damaging Het
Vmn1r89 A G 7: 13,219,540 M68V probably benign Het
Vmn2r105 C T 17: 20,227,711 E284K probably benign Het
Vmn2r105 T C 17: 20,227,857 D235G probably damaging Het
Vmn2r-ps134 C T 17: 23,446,041 noncoding transcript Het
Zdbf2 G A 1: 63,305,723 S1087N possibly damaging Het
Zfp534 G A 4: 147,674,236 P659S probably damaging Het
Other mutations in Arhgef38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Arhgef38 APN 3 133132051 missense probably benign 0.05
IGL00533:Arhgef38 APN 3 133116459 nonsense probably null
IGL03031:Arhgef38 APN 3 133132067 missense possibly damaging 0.90
F5770:Arhgef38 UTSW 3 133149540 missense probably damaging 1.00
PIT4362001:Arhgef38 UTSW 3 133160830 missense
R0050:Arhgef38 UTSW 3 133132196 missense probably damaging 0.99
R0050:Arhgef38 UTSW 3 133132196 missense probably damaging 0.99
R0076:Arhgef38 UTSW 3 133160746 missense possibly damaging 0.52
R0515:Arhgef38 UTSW 3 133149540 missense probably damaging 1.00
R0730:Arhgef38 UTSW 3 133137471 missense probably benign 0.25
R1054:Arhgef38 UTSW 3 133116465 missense probably damaging 1.00
R1261:Arhgef38 UTSW 3 133160863 missense possibly damaging 0.52
R1568:Arhgef38 UTSW 3 133132464 missense probably damaging 0.98
R1580:Arhgef38 UTSW 3 133133704 missense probably benign 0.24
R1716:Arhgef38 UTSW 3 133140837 missense probably benign 0.35
R1875:Arhgef38 UTSW 3 133133740 critical splice acceptor site probably null
R2118:Arhgef38 UTSW 3 133160753 missense probably benign 0.31
R2119:Arhgef38 UTSW 3 133160753 missense probably benign 0.31
R2122:Arhgef38 UTSW 3 133160753 missense probably benign 0.31
R2417:Arhgef38 UTSW 3 133146473 missense probably damaging 1.00
R3832:Arhgef38 UTSW 3 133206925 missense possibly damaging 0.89
R4657:Arhgef38 UTSW 3 133234681 missense probably damaging 1.00
R4666:Arhgef38 UTSW 3 133140772 critical splice donor site probably null
R4732:Arhgef38 UTSW 3 133132269 nonsense probably null
R4733:Arhgef38 UTSW 3 133132269 nonsense probably null
R5059:Arhgef38 UTSW 3 133137414 missense probably damaging 1.00
R5108:Arhgef38 UTSW 3 133137268 missense probably benign 0.14
R5310:Arhgef38 UTSW 3 133116466 missense probably damaging 0.98
R5820:Arhgef38 UTSW 3 133160799 missense probably benign 0.44
R5987:Arhgef38 UTSW 3 133206958 missense possibly damaging 0.67
R6115:Arhgef38 UTSW 3 133132613 splice site probably null
R6313:Arhgef38 UTSW 3 133234708 missense possibly damaging 0.80
R6339:Arhgef38 UTSW 3 133133662 missense probably benign 0.35
R6356:Arhgef38 UTSW 3 133140877 missense probably benign 0.01
R6648:Arhgef38 UTSW 3 133132475 missense probably damaging 1.00
R7050:Arhgef38 UTSW 3 133133627 start gained probably benign
R7083:Arhgef38 UTSW 3 133132436 missense unknown
R7561:Arhgef38 UTSW 3 133160728 missense
R7769:Arhgef38 UTSW 3 133149622 missense unknown
R8050:Arhgef38 UTSW 3 133137562 nonsense probably null
R8471:Arhgef38 UTSW 3 133234711 missense probably damaging 1.00
R8835:Arhgef38 UTSW 3 133132071 missense unknown
R9151:Arhgef38 UTSW 3 133206945 missense
R9154:Arhgef38 UTSW 3 133132163 missense unknown
R9263:Arhgef38 UTSW 3 133160768 missense
R9367:Arhgef38 UTSW 3 133142237 missense unknown
Z1177:Arhgef38 UTSW 3 133206961 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGGGAAGCAAGATTTGTCTTCAAAACG -3'
(R):5'- GTGTGACTGTCAAAAGCAAGAACACC -3'

Sequencing Primer
(F):5'- GTCTTCAAAACGTGATACACTGTTC -3'
(R):5'- GAACACCTTAGCAGTGCTTC -3'
Posted On 2013-09-30