Incidental Mutation 'R9641:Abcg3'
ID 725972
Institutional Source Beutler Lab
Gene Symbol Abcg3
Ensembl Gene ENSMUSG00000029299
Gene Name ATP binding cassette subfamily G member 3
Synonyms Abcp2, Mxr2
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R9641 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 105082923-105130584 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 105084483 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 571 (S571A)
Ref Sequence ENSEMBL: ENSMUSP00000120179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031239] [ENSMUST00000130644]
AlphaFold Q99P81
Predicted Effect probably benign
Transcript: ENSMUST00000031239
SMART Domains Protein: ENSMUSP00000031239
Gene: ENSMUSG00000029299

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 5.9e-9 PFAM
Pfam:ABC2_membrane 367 578 1.8e-29 PFAM
transmembrane domain 623 642 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130644
AA Change: S571A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120179
Gene: ENSMUSG00000029299
AA Change: S571A

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 7.6e-9 PFAM
transmembrane domain 386 408 N/A INTRINSIC
Pfam:ABC2_membrane 414 548 1.9e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. It lacks several highly conserved residues found in other ATP-binding proteins; this suggests that this protein may not bind ATP and may require dimerization with another subunit to form a functional ATP-transporter. The function of this gene has not yet been determined; however, high levels of expression in the thymus and spleen suggest a potential role in the transport of specific peptides or hydrophobic compounds from lymphocytes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T C 10: 100,430,498 (GRCm39) F52L possibly damaging Het
Abca16 T C 7: 120,126,308 (GRCm39) C1156R possibly damaging Het
Abi3 C A 11: 95,724,503 (GRCm39) L259F unknown Het
Adam19 A T 11: 46,027,149 (GRCm39) D594V probably damaging Het
Adam34 C T 8: 44,104,076 (GRCm39) S523N probably damaging Het
Adam6b G T 12: 113,454,176 (GRCm39) C331F probably benign Het
Adamts14 A T 10: 61,106,829 (GRCm39) V97E probably damaging Het
Adipor1 T C 1: 134,355,878 (GRCm39) Y226H probably damaging Het
Alox12e T C 11: 70,212,261 (GRCm39) Y139C probably damaging Het
Ankrd53 A G 6: 83,740,692 (GRCm39) D160G possibly damaging Het
Ap1m1 A T 8: 73,003,606 (GRCm39) Y94F probably damaging Het
Arhgef28 A C 13: 98,078,983 (GRCm39) D1314E probably benign Het
Bicc1 A G 10: 70,863,772 (GRCm39) I90T probably benign Het
Celf6 A G 9: 59,485,833 (GRCm39) D58G probably damaging Het
Cfap74 T C 4: 155,549,054 (GRCm39) S38P unknown Het
Cps1 A G 1: 67,234,342 (GRCm39) I910V probably benign Het
Cracdl C T 1: 37,663,592 (GRCm39) A769T possibly damaging Het
Crybg2 C T 4: 133,816,620 (GRCm39) Q1353* probably null Het
Cyp4f39 T C 17: 32,705,982 (GRCm39) Y358H probably damaging Het
Dcp1a T A 14: 30,241,132 (GRCm39) I314N probably damaging Het
Dgki A C 6: 37,126,489 (GRCm39) W164G probably damaging Het
Dnah8 A G 17: 30,932,029 (GRCm39) I1466V probably benign Het
Efcab6 T A 15: 83,763,676 (GRCm39) R1219W probably damaging Het
Faap24 A T 7: 35,094,494 (GRCm39) F102Y probably damaging Het
Fam186a T C 15: 99,838,244 (GRCm39) T2667A probably benign Het
Frem1 C T 4: 82,877,653 (GRCm39) G1308D probably damaging Het
Hectd1 T C 12: 51,816,047 (GRCm39) T1347A probably benign Het
Hipk3 A T 2: 104,267,376 (GRCm39) H620Q probably benign Het
Hpd A G 5: 123,310,052 (GRCm39) S391P probably benign Het
Ino80 A G 2: 119,275,965 (GRCm39) V437A probably benign Het
Itgax G T 7: 127,741,152 (GRCm39) G785C probably damaging Het
Kcnk18 C T 19: 59,223,266 (GRCm39) T137I probably damaging Het
Kif16b A G 2: 142,542,589 (GRCm39) F236L probably benign Het
Lamb1 T C 12: 31,337,457 (GRCm39) M396T probably damaging Het
Lrfn5 C A 12: 61,886,540 (GRCm39) N109K probably damaging Het
Lrrc15 T A 16: 30,093,006 (GRCm39) N111I probably damaging Het
Lrrk2 A T 15: 91,671,251 (GRCm39) I2011F possibly damaging Het
Lsr A G 7: 30,658,285 (GRCm39) I336T probably damaging Het
Mettl21e T A 1: 44,250,351 (GRCm39) R18S probably benign Het
Mrpl22 T C 11: 58,068,047 (GRCm39) L115P probably damaging Het
N4bp2 T A 5: 65,948,035 (GRCm39) S222T probably benign Het
Nat2 A G 8: 67,954,522 (GRCm39) T211A probably benign Het
Nbeal1 T A 1: 60,350,247 (GRCm39) I2432N probably damaging Het
Neb A G 2: 52,112,783 (GRCm39) I1158T Het
Nrip3 C T 7: 109,362,793 (GRCm39) E164K probably damaging Het
Obox6 G A 7: 15,568,742 (GRCm39) Q45* probably null Het
Ola1 T C 2: 73,033,784 (GRCm39) N44D probably benign Het
Or1x6 C T 11: 50,939,207 (GRCm39) T91M probably benign Het
Or2y1c T C 11: 49,361,509 (GRCm39) F177S probably damaging Het
Or5b111 A T 19: 13,291,100 (GRCm39) M183K probably damaging Het
Or5d39 A T 2: 87,980,255 (GRCm39) I36N possibly damaging Het
Or5p81 A T 7: 108,267,516 (GRCm39) N298Y probably damaging Het
Or6ae1 A G 7: 139,742,771 (GRCm39) F31L probably benign Het
Or8b51 T A 9: 38,568,915 (GRCm39) M258L probably benign Het
Pde10a A G 17: 9,197,816 (GRCm39) K753R Het
Phldb1 T C 9: 44,627,839 (GRCm39) D202G probably damaging Het
Pik3cb T C 9: 98,955,789 (GRCm39) N376S probably benign Het
Plekhh2 A G 17: 84,874,130 (GRCm39) N472D probably damaging Het
Ppp4r4 T A 12: 103,567,811 (GRCm39) F708Y probably benign Het
Rnf157 A G 11: 116,303,576 (GRCm39) V12A probably benign Het
Saa3 T C 7: 46,364,494 (GRCm39) I11V probably benign Het
Sall2 T C 14: 52,550,882 (GRCm39) E771G probably damaging Het
Sar1b C T 11: 51,670,573 (GRCm39) T39I probably damaging Het
Scn10a A T 9: 119,445,869 (GRCm39) L1428Q possibly damaging Het
Sema3f A G 9: 107,565,454 (GRCm39) I213T unknown Het
Serpina3m C T 12: 104,360,085 (GRCm39) Q386* probably null Het
Sh3gl3 G A 7: 81,909,370 (GRCm39) G26R probably damaging Het
Shq1 T C 6: 100,550,633 (GRCm39) E435G probably damaging Het
Sidt2 G T 9: 45,864,495 (GRCm39) A78E probably benign Het
Sin3b A G 8: 73,477,187 (GRCm39) Y818C probably damaging Het
Smarca2 C T 19: 26,656,498 (GRCm39) L825F possibly damaging Het
Srgn T A 10: 62,330,884 (GRCm39) M74L probably benign Het
Tbc1d22b A C 17: 29,813,747 (GRCm39) D360A possibly damaging Het
Tbx4 A G 11: 85,803,128 (GRCm39) R335G probably damaging Het
Tmem144 T C 3: 79,734,200 (GRCm39) N168D probably benign Het
Trip11 G A 12: 101,859,957 (GRCm39) Q307* probably null Het
Ttyh2 T C 11: 114,598,516 (GRCm39) Y296H probably damaging Het
Vmn1r236 G T 17: 21,507,043 (GRCm39) V54F probably benign Het
Xrra1 A C 7: 99,561,088 (GRCm39) H443P probably benign Het
Zc3h12a T C 4: 125,014,852 (GRCm39) T211A probably damaging Het
Zfp386 T G 12: 116,023,330 (GRCm39) D349E probably benign Het
Zkscan16 T A 4: 58,956,577 (GRCm39) H286Q probably benign Het
Znrf2 C T 6: 54,861,788 (GRCm39) P233L probably damaging Het
Other mutations in Abcg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Abcg3 APN 5 105,083,878 (GRCm39) missense probably benign 0.02
IGL01363:Abcg3 APN 5 105,096,228 (GRCm39) missense possibly damaging 0.55
IGL02097:Abcg3 APN 5 105,109,052 (GRCm39) missense possibly damaging 0.77
IGL02554:Abcg3 APN 5 105,117,318 (GRCm39) missense possibly damaging 0.48
IGL02561:Abcg3 APN 5 105,125,536 (GRCm39) missense probably benign 0.18
IGL02974:Abcg3 APN 5 105,116,129 (GRCm39) missense probably damaging 1.00
IGL03058:Abcg3 APN 5 105,109,112 (GRCm39) missense probably benign 0.00
IGL03153:Abcg3 APN 5 105,122,631 (GRCm39) splice site probably benign
IGL03377:Abcg3 APN 5 105,096,256 (GRCm39) missense probably benign 0.01
R0110:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0469:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0510:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0530:Abcg3 UTSW 5 105,083,920 (GRCm39) missense probably damaging 1.00
R0579:Abcg3 UTSW 5 105,121,969 (GRCm39) missense probably damaging 1.00
R1237:Abcg3 UTSW 5 105,096,223 (GRCm39) missense probably damaging 0.96
R1505:Abcg3 UTSW 5 105,099,431 (GRCm39) missense probably damaging 1.00
R1627:Abcg3 UTSW 5 105,083,880 (GRCm39) missense probably benign 0.00
R1717:Abcg3 UTSW 5 105,111,421 (GRCm39) nonsense probably null
R1797:Abcg3 UTSW 5 105,087,030 (GRCm39) missense possibly damaging 0.66
R1899:Abcg3 UTSW 5 105,086,065 (GRCm39) missense probably damaging 0.99
R1974:Abcg3 UTSW 5 105,111,504 (GRCm39) missense probably benign 0.01
R2136:Abcg3 UTSW 5 105,114,680 (GRCm39) missense probably benign 0.04
R2285:Abcg3 UTSW 5 105,087,037 (GRCm39) missense probably damaging 1.00
R3880:Abcg3 UTSW 5 105,086,046 (GRCm39) splice site probably benign
R4242:Abcg3 UTSW 5 105,109,079 (GRCm39) missense probably benign
R4738:Abcg3 UTSW 5 105,121,849 (GRCm39) missense probably benign
R5225:Abcg3 UTSW 5 105,114,649 (GRCm39) missense probably damaging 1.00
R5309:Abcg3 UTSW 5 105,084,465 (GRCm39) missense possibly damaging 0.53
R5704:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R5705:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R5785:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R6155:Abcg3 UTSW 5 105,111,510 (GRCm39) missense probably benign 0.00
R6309:Abcg3 UTSW 5 105,117,259 (GRCm39) critical splice donor site probably null
R6814:Abcg3 UTSW 5 105,083,860 (GRCm39) missense probably benign
R6872:Abcg3 UTSW 5 105,083,860 (GRCm39) missense probably benign
R6916:Abcg3 UTSW 5 105,122,601 (GRCm39) missense probably benign 0.16
R7217:Abcg3 UTSW 5 105,087,094 (GRCm39) missense possibly damaging 0.75
R7310:Abcg3 UTSW 5 105,114,632 (GRCm39) missense probably benign 0.01
R7343:Abcg3 UTSW 5 105,116,100 (GRCm39) missense probably benign 0.00
R7401:Abcg3 UTSW 5 105,114,640 (GRCm39) missense probably damaging 0.99
R7531:Abcg3 UTSW 5 105,125,507 (GRCm39) missense probably benign
R7685:Abcg3 UTSW 5 105,116,081 (GRCm39) missense probably damaging 1.00
R7728:Abcg3 UTSW 5 105,083,944 (GRCm39) missense probably benign 0.00
R7819:Abcg3 UTSW 5 105,125,594 (GRCm39) missense probably benign 0.05
R7942:Abcg3 UTSW 5 105,087,027 (GRCm39) missense probably damaging 1.00
R8059:Abcg3 UTSW 5 105,100,948 (GRCm39) critical splice donor site probably null
R9181:Abcg3 UTSW 5 105,121,962 (GRCm39) missense probably benign
R9529:Abcg3 UTSW 5 105,121,973 (GRCm39) missense probably damaging 1.00
X0022:Abcg3 UTSW 5 105,096,282 (GRCm39) missense probably benign 0.02
X0026:Abcg3 UTSW 5 105,086,055 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTGCTCTCTTCAACAGG -3'
(R):5'- CAGGAATAGACTCCCAGCTG -3'

Sequencing Primer
(F):5'- CTCTTCAACAGGCAAAAGCATGTTTC -3'
(R):5'- CTGGCATTCCCCTATGTTGGG -3'
Posted On 2022-09-12