Incidental Mutation 'R9641:Alox12e'
ID 726009
Institutional Source Beutler Lab
Gene Symbol Alox12e
Ensembl Gene ENSMUSG00000018907
Gene Name arachidonate lipoxygenase, epidermal
Synonyms 8-LOX, Alox12-ps1, Alox12-ps2, Aloxe, e-LOX1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9641 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 70315610-70322628 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70321435 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 139 (Y139C)
Ref Sequence ENSEMBL: ENSMUSP00000019051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019051]
AlphaFold P55249
Predicted Effect probably damaging
Transcript: ENSMUST00000019051
AA Change: Y139C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019051
Gene: ENSMUSG00000018907
AA Change: Y139C

DomainStartEndE-ValueType
LH2 2 111 9.49e-38 SMART
Pfam:Lipoxygenase 163 649 1.2e-60 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T C 10: 100,594,636 F52L possibly damaging Het
2010300C02Rik C T 1: 37,624,511 A769T possibly damaging Het
Abca16 T C 7: 120,527,085 C1156R possibly damaging Het
Abcg3 A C 5: 104,936,617 S571A probably benign Het
Abi3 C A 11: 95,833,677 L259F unknown Het
Adam19 A T 11: 46,136,322 D594V probably damaging Het
Adam34 C T 8: 43,651,039 S523N probably damaging Het
Adam6b G T 12: 113,490,556 C331F probably benign Het
Adamts14 A T 10: 61,271,050 V97E probably damaging Het
Adipor1 T C 1: 134,428,140 Y226H probably damaging Het
Ankrd53 A G 6: 83,763,710 D160G possibly damaging Het
Ap1m1 A T 8: 72,249,762 Y94F probably damaging Het
Arhgef28 A C 13: 97,942,475 D1314E probably benign Het
Bicc1 A G 10: 71,027,942 I90T probably benign Het
Celf6 A G 9: 59,578,550 D58G probably damaging Het
Cfap74 T C 4: 155,464,597 S38P unknown Het
Cps1 A G 1: 67,195,183 I910V probably benign Het
Crybg2 C T 4: 134,089,309 Q1353* probably null Het
Cyp4f39 T C 17: 32,487,008 Y358H probably damaging Het
Dcp1a T A 14: 30,519,175 I314N probably damaging Het
Dgki A C 6: 37,149,554 W164G probably damaging Het
Dnah8 A G 17: 30,713,055 I1466V probably benign Het
Efcab6 T A 15: 83,879,475 R1219W probably damaging Het
Faap24 A T 7: 35,395,069 F102Y probably damaging Het
Fam186a T C 15: 99,940,363 T2667A probably benign Het
Frem1 C T 4: 82,959,416 G1308D probably damaging Het
Hectd1 T C 12: 51,769,264 T1347A probably benign Het
Hipk3 A T 2: 104,437,031 H620Q probably benign Het
Hpd A G 5: 123,171,989 S391P probably benign Het
Ino80 A G 2: 119,445,484 V437A probably benign Het
Itgax G T 7: 128,141,980 G785C probably damaging Het
Kcnk18 C T 19: 59,234,834 T137I probably damaging Het
Kif16b A G 2: 142,700,669 F236L probably benign Het
Lamb1 T C 12: 31,287,458 M396T probably damaging Het
Lrfn5 C A 12: 61,839,754 N109K probably damaging Het
Lrrc15 T A 16: 30,274,188 N111I probably damaging Het
Lrrk2 A T 15: 91,787,048 I2011F possibly damaging Het
Lsr A G 7: 30,958,860 I336T probably damaging Het
Mettl21e T A 1: 44,211,191 R18S probably benign Het
Mrpl22 T C 11: 58,177,221 L115P probably damaging Het
N4bp2 T A 5: 65,790,692 S222T probably benign Het
Nat2 A G 8: 67,501,870 T211A probably benign Het
Nbeal1 T A 1: 60,311,088 I2432N probably damaging Het
Neb A G 2: 52,222,771 I1158T Het
Nrip3 C T 7: 109,763,586 E164K probably damaging Het
Obox6 G A 7: 15,834,817 Q45* probably null Het
Ola1 T C 2: 73,203,440 N44D probably benign Het
Olfr1167 A T 2: 88,149,911 I36N possibly damaging Het
Olfr1375 C T 11: 51,048,380 T91M probably benign Het
Olfr1386 T C 11: 49,470,682 F177S probably damaging Het
Olfr1465 A T 19: 13,313,736 M183K probably damaging Het
Olfr510 A T 7: 108,668,309 N298Y probably damaging Het
Olfr522 A G 7: 140,162,858 F31L probably benign Het
Olfr916 T A 9: 38,657,619 M258L probably benign Het
Pde10a A G 17: 8,978,984 K753R Het
Phldb1 T C 9: 44,716,542 D202G probably damaging Het
Pik3cb T C 9: 99,073,736 N376S probably benign Het
Plekhh2 A G 17: 84,566,702 N472D probably damaging Het
Ppp4r4 T A 12: 103,601,552 F708Y probably benign Het
Rnf157 A G 11: 116,412,750 V12A probably benign Het
Saa3 T C 7: 46,715,070 I11V probably benign Het
Sall2 T C 14: 52,313,425 E771G probably damaging Het
Sar1b C T 11: 51,779,746 T39I probably damaging Het
Scn10a A T 9: 119,616,803 L1428Q possibly damaging Het
Sema3f A G 9: 107,688,255 I213T unknown Het
Serpina3m C T 12: 104,393,826 Q386* probably null Het
Sh3gl3 G A 7: 82,260,162 G26R probably damaging Het
Shq1 T C 6: 100,573,672 E435G probably damaging Het
Sidt2 G T 9: 45,953,197 A78E probably benign Het
Sin3b A G 8: 72,750,559 Y818C probably damaging Het
Smarca2 C T 19: 26,679,098 L825F possibly damaging Het
Srgn T A 10: 62,495,105 M74L probably benign Het
Tbc1d22b A C 17: 29,594,773 D360A possibly damaging Het
Tbx4 A G 11: 85,912,302 R335G probably damaging Het
Tmem144 T C 3: 79,826,893 N168D probably benign Het
Trip11 G A 12: 101,893,698 Q307* probably null Het
Ttyh2 T C 11: 114,707,690 Y296H probably damaging Het
Vmn1r236 G T 17: 21,286,781 V54F probably benign Het
Xrra1 A C 7: 99,911,881 H443P probably benign Het
Zc3h12a T C 4: 125,121,059 T211A probably damaging Het
Zfp386 T G 12: 116,059,710 D349E probably benign Het
Zkscan16 T A 4: 58,956,577 H286Q probably benign Het
Znrf2 C T 6: 54,884,803 P233L probably damaging Het
Other mutations in Alox12e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Alox12e APN 11 70321054 missense probably benign
IGL01781:Alox12e APN 11 70321456 missense probably damaging 1.00
R0284:Alox12e UTSW 11 70320899 splice site probably benign
R0417:Alox12e UTSW 11 70321865 missense probably benign 0.12
R0557:Alox12e UTSW 11 70321448 missense possibly damaging 0.80
R0593:Alox12e UTSW 11 70320897 splice site probably benign
R1479:Alox12e UTSW 11 70320782 missense probably benign 0.04
R1967:Alox12e UTSW 11 70317856 missense probably benign 0.18
R1996:Alox12e UTSW 11 70316208 missense probably benign 0.00
R2062:Alox12e UTSW 11 70316002 missense probably damaging 1.00
R2063:Alox12e UTSW 11 70316002 missense probably damaging 1.00
R2067:Alox12e UTSW 11 70316002 missense probably damaging 1.00
R2068:Alox12e UTSW 11 70316002 missense probably damaging 1.00
R2147:Alox12e UTSW 11 70319945 missense probably damaging 1.00
R2307:Alox12e UTSW 11 70321261 missense probably damaging 1.00
R3034:Alox12e UTSW 11 70316253 missense probably benign 0.01
R3739:Alox12e UTSW 11 70319842 missense probably damaging 1.00
R4463:Alox12e UTSW 11 70318256 missense probably damaging 1.00
R4572:Alox12e UTSW 11 70321181 intron probably benign
R5004:Alox12e UTSW 11 70321504 missense probably benign 0.00
R5113:Alox12e UTSW 11 70315995 missense possibly damaging 0.70
R5155:Alox12e UTSW 11 70316255 missense possibly damaging 0.61
R5464:Alox12e UTSW 11 70317679 missense probably damaging 0.99
R5471:Alox12e UTSW 11 70320024 missense probably benign 0.17
R5501:Alox12e UTSW 11 70316229 missense probably benign 0.01
R5915:Alox12e UTSW 11 70318224 missense possibly damaging 0.81
R6033:Alox12e UTSW 11 70316013 missense probably benign 0.03
R6033:Alox12e UTSW 11 70316013 missense probably benign 0.03
R6102:Alox12e UTSW 11 70320023 missense possibly damaging 0.65
R6380:Alox12e UTSW 11 70321101 missense probably benign 0.00
R6452:Alox12e UTSW 11 70320005 missense probably damaging 0.96
R7175:Alox12e UTSW 11 70319708 missense probably damaging 1.00
R7220:Alox12e UTSW 11 70315905 missense probably benign 0.02
R7353:Alox12e UTSW 11 70321435 missense probably damaging 1.00
R7542:Alox12e UTSW 11 70321756 missense possibly damaging 0.69
R7916:Alox12e UTSW 11 70321285 missense probably benign
R8314:Alox12e UTSW 11 70316172 missense possibly damaging 0.83
R8331:Alox12e UTSW 11 70321097 missense probably benign 0.01
R9027:Alox12e UTSW 11 70321774 missense possibly damaging 0.68
R9380:Alox12e UTSW 11 70316168 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCATGAATCTCTGGTTCCGGG -3'
(R):5'- ACTATCTGCCTAACCGAGGG -3'

Sequencing Primer
(F):5'- ATCTCTGGTTCCGGGGGAGG -3'
(R):5'- TGCCGCTGAAGGATGCAG -3'
Posted On 2022-09-12