Incidental Mutation 'R9642:Muc5ac'
ID 726072
Institutional Source Beutler Lab
Gene Symbol Muc5ac
Ensembl Gene ENSMUSG00000037974
Gene Name mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms MGM, 2210005L13Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9642 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 141342709-141372968 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 141349601 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 505 (T505S)
Ref Sequence ENSEMBL: ENSMUSP00000122353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041924] [ENSMUST00000155534] [ENSMUST00000163321]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000041924
AA Change: T504S

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000039699
Gene: ENSMUSG00000037974
AA Change: T504S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 1.6e-14 PFAM
VWC 395 462 8.6e-18 SMART
VWD 421 585 1.55e-33 SMART
C8 622 696 8.42e-36 SMART
Pfam:TIL 702 759 6.1e-9 PFAM
VWC 761 825 6.75e-1 SMART
VWC 863 905 4.06e-1 SMART
VWD 890 1050 1.51e-45 SMART
C8 1086 1160 2.78e-36 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1333 1366 N/A INTRINSIC
low complexity region 1371 1387 N/A INTRINSIC
Pfam:Mucin2_WxxW 1394 1482 2.3e-25 PFAM
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1536 1563 N/A INTRINSIC
low complexity region 1578 1595 N/A INTRINSIC
Pfam:Mucin2_WxxW 1604 1692 2.2e-27 PFAM
Pfam:Mucin2_WxxW 1765 1857 8.6e-27 PFAM
low complexity region 1875 1895 N/A INTRINSIC
low complexity region 1949 1968 N/A INTRINSIC
VWD 2030 2199 4.17e-48 SMART
C8 2242 2311 3.95e-9 SMART
VWC 2376 2439 1.04e-11 SMART
VWC 2479 2543 9.31e-5 SMART
CT 2625 2711 3.43e-32 SMART
low complexity region 2720 2733 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000155534
AA Change: T505S

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122353
Gene: ENSMUSG00000037974
AA Change: T505S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 9.6e-15 PFAM
VWC 395 437 3.54e-1 SMART
VWD 422 586 2.35e-33 SMART
C8 623 697 8.42e-36 SMART
Pfam:TIL 703 760 3.6e-9 PFAM
VWC 762 826 6.75e-1 SMART
VWC 864 906 4.06e-1 SMART
VWD 891 1051 1.51e-45 SMART
C8 1087 1161 2.78e-36 SMART
low complexity region 1316 1331 N/A INTRINSIC
low complexity region 1334 1367 N/A INTRINSIC
low complexity region 1372 1388 N/A INTRINSIC
Pfam:Mucin2_WxxW 1395 1483 1.3e-25 PFAM
low complexity region 1522 1533 N/A INTRINSIC
low complexity region 1537 1564 N/A INTRINSIC
low complexity region 1579 1596 N/A INTRINSIC
Pfam:Mucin2_WxxW 1605 1693 1.3e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163321
AA Change: T504S

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131681
Gene: ENSMUSG00000037974
AA Change: T504S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 7.9e-15 PFAM
VWC 395 462 8.6e-18 SMART
VWD 421 585 1.55e-33 SMART
C8 622 696 8.42e-36 SMART
Pfam:TIL 702 759 1.9e-9 PFAM
VWC 761 825 6.75e-1 SMART
VWC 863 905 4.06e-1 SMART
VWD 890 1050 1.51e-45 SMART
C8 1086 1160 2.78e-36 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1333 1366 N/A INTRINSIC
low complexity region 1371 1387 N/A INTRINSIC
Pfam:Mucin2_WxxW 1394 1481 1.1e-23 PFAM
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1536 1563 N/A INTRINSIC
low complexity region 1578 1595 N/A INTRINSIC
Pfam:Mucin2_WxxW 1604 1691 1.1e-25 PFAM
Pfam:Mucin2_WxxW 1765 1856 6.3e-24 PFAM
low complexity region 1875 1895 N/A INTRINSIC
low complexity region 1949 1968 N/A INTRINSIC
VWD 2030 2199 4.17e-48 SMART
C8 2242 2311 3.95e-9 SMART
VWC 2376 2439 1.04e-11 SMART
VWC 2479 2543 9.31e-5 SMART
CT 2625 2711 3.43e-32 SMART
low complexity region 2720 2733 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to T. muris infection with persistent worm burden, goblet cell hyperplasia, and increased serum IFN-gamma despite a normal TH2-type immune response. A portion of mice show corneal opacity and poor tear quality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,619,412 (GRCm39) probably null Het
Aadacl3 A G 4: 144,182,512 (GRCm39) S319P probably benign Het
Abcc6 C A 7: 45,639,765 (GRCm39) D907Y probably benign Het
Apol7b T C 15: 77,308,103 (GRCm39) S131G probably benign Het
Atg2a C T 19: 6,300,198 (GRCm39) R669* probably null Het
Atr T A 9: 95,821,294 (GRCm39) I2260N probably damaging Het
Bmper T A 9: 23,395,198 (GRCm39) V643E probably benign Het
Cacna2d2 A G 9: 107,392,627 (GRCm39) I524V possibly damaging Het
Ccdc171 C A 4: 83,599,525 (GRCm39) A780E probably benign Het
Cdcp3 C A 7: 130,848,257 (GRCm39) Q688K probably benign Het
Cfhr2 A G 1: 139,738,620 (GRCm39) S314P probably damaging Het
Cops2 A T 2: 125,682,410 (GRCm39) D190E probably benign Het
Dmxl1 G A 18: 50,013,825 (GRCm39) G1538R probably damaging Het
Dyrk4 A T 6: 126,893,253 (GRCm39) V43E probably benign Het
Eif4a3l2 A G 6: 116,528,350 (GRCm39) R76G probably damaging Het
Enoph1 T C 5: 100,188,115 (GRCm39) I13T possibly damaging Het
Eya3 A T 4: 132,426,374 (GRCm39) I268F probably damaging Het
Ezh2 A C 6: 47,521,453 (GRCm39) M439R probably benign Het
Fam83c T C 2: 155,672,980 (GRCm39) N259S probably damaging Het
Gbf1 A T 19: 46,258,707 (GRCm39) M963L probably benign Het
Ghr A T 15: 3,355,469 (GRCm39) D271E probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,450 (GRCm39) probably benign Het
Gtse1 T A 15: 85,751,697 (GRCm39) L297I probably damaging Het
Hecw1 T A 13: 14,515,394 (GRCm39) H246L probably damaging Het
Hmox1 G A 8: 75,823,881 (GRCm39) R183H possibly damaging Het
Ifi202b A T 1: 173,799,850 (GRCm39) Y210* probably null Het
Ighv1-76 A T 12: 115,811,918 (GRCm39) I6N possibly damaging Het
Ildr1 T A 16: 36,536,490 (GRCm39) I173N probably damaging Het
Jaml T C 9: 45,000,116 (GRCm39) V138A probably damaging Het
Kmt2b A T 7: 30,283,340 (GRCm39) probably null Het
Krt87 T C 15: 101,385,074 (GRCm39) N341D probably benign Het
Map3k20 T C 2: 72,272,181 (GRCm39) W770R probably damaging Het
Mast2 A G 4: 116,170,966 (GRCm39) I667T probably damaging Het
Mdp1 T C 14: 55,896,933 (GRCm39) T71A probably damaging Het
Mx1 A G 16: 97,256,376 (GRCm39) V181A probably damaging Het
Myo15b A G 11: 115,772,335 (GRCm39) E83G possibly damaging Het
Ncam2 A T 16: 81,418,251 (GRCm39) I769L probably benign Het
Notum T C 11: 120,550,980 (GRCm39) D62G probably damaging Het
Or4c124 A T 2: 89,155,907 (GRCm39) C206S possibly damaging Het
Or5ac22 A T 16: 59,135,610 (GRCm39) H53Q possibly damaging Het
Or7a39 C T 10: 78,715,395 (GRCm39) P130S probably damaging Het
Or8g32 T C 9: 39,305,857 (GRCm39) S254P probably damaging Het
P2rx2 A G 5: 110,489,878 (GRCm39) S196P possibly damaging Het
Pcdh7 A T 5: 57,876,717 (GRCm39) I91F probably damaging Het
Peak1 A G 9: 56,167,205 (GRCm39) V241A probably benign Het
Ppl C A 16: 4,915,602 (GRCm39) R623S probably benign Het
Prkaca A G 8: 84,717,088 (GRCm39) I151V probably benign Het
Psmb11 A T 14: 54,863,295 (GRCm39) Q171L probably benign Het
Rab3gap2 T G 1: 184,967,692 (GRCm39) F166V probably benign Het
Rab7 G A 6: 87,981,187 (GRCm39) A165V probably damaging Het
Ranbp2 T C 10: 58,318,907 (GRCm39) Y2473H probably damaging Het
Runx3 A G 4: 134,848,341 (GRCm39) probably benign Het
Sh3bp5l T A 11: 58,237,085 (GRCm39) C347* probably null Het
Smc5 A G 19: 23,238,752 (GRCm39) M208T probably damaging Het
Stk11ip T C 1: 75,510,899 (GRCm39) probably null Het
Tas2r136 A T 6: 132,754,462 (GRCm39) C222S probably benign Het
Themis2 A G 4: 132,513,047 (GRCm39) V393A possibly damaging Het
Tln2 A C 9: 67,157,826 (GRCm39) V1171G probably benign Het
Tmem63a T C 1: 180,776,393 (GRCm39) F68L probably damaging Het
Tpst1 T A 5: 130,130,959 (GRCm39) L143Q probably damaging Het
Trp63 C A 16: 25,682,508 (GRCm39) Q284K probably benign Het
Ttc17 T C 2: 94,194,735 (GRCm39) E546G probably benign Het
Ttn A G 2: 76,804,570 (GRCm39) I234T unknown Het
Upp1 A G 11: 9,085,206 (GRCm39) K231R probably benign Het
Uso1 T A 5: 92,285,967 (GRCm39) L4H probably damaging Het
Vmn1r9 T A 6: 57,048,216 (GRCm39) L97Q probably damaging Het
Vmn2r107 T C 17: 20,580,661 (GRCm39) C533R probably damaging Het
Vps35l C A 7: 118,437,451 (GRCm39) D909E probably benign Het
Wdr90 A G 17: 26,072,694 (GRCm39) probably null Het
Ydjc A G 16: 16,966,073 (GRCm39) H219R probably benign Het
Ykt6 T C 11: 5,905,917 (GRCm39) L6P probably damaging Het
Zfp236 A G 18: 82,622,384 (GRCm39) V1682A probably benign Het
Zfp35 C T 18: 24,137,155 (GRCm39) Q500* probably null Het
Zfp780b T A 7: 27,664,135 (GRCm39) D140V probably benign Het
Zyg11b T C 4: 108,117,185 (GRCm39) T352A probably damaging Het
Other mutations in Muc5ac
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Muc5ac APN 7 141,366,440 (GRCm39) missense possibly damaging 0.93
IGL01064:Muc5ac APN 7 141,361,210 (GRCm39) missense probably benign 0.12
IGL01155:Muc5ac APN 7 141,360,680 (GRCm39) splice site probably benign
IGL01452:Muc5ac APN 7 141,371,292 (GRCm39) missense probably benign 0.00
IGL01590:Muc5ac APN 7 141,352,630 (GRCm39) missense probably benign 0.02
IGL02104:Muc5ac APN 7 141,364,815 (GRCm39) missense probably damaging 0.98
IGL02152:Muc5ac APN 7 141,353,914 (GRCm39) missense possibly damaging 0.86
IGL02153:Muc5ac APN 7 141,372,537 (GRCm39) nonsense probably null
IGL02178:Muc5ac APN 7 141,359,184 (GRCm39) splice site probably benign
IGL02403:Muc5ac APN 7 141,357,187 (GRCm39) missense possibly damaging 0.71
IGL02576:Muc5ac APN 7 141,370,781 (GRCm39) missense probably benign 0.01
IGL02665:Muc5ac APN 7 141,344,823 (GRCm39) missense possibly damaging 0.71
IGL02704:Muc5ac APN 7 141,349,000 (GRCm39) missense possibly damaging 0.71
IGL02808:Muc5ac APN 7 141,359,512 (GRCm39) missense possibly damaging 0.72
IGL03283:Muc5ac APN 7 141,367,518 (GRCm39) missense probably benign 0.34
IGL03384:Muc5ac APN 7 141,366,140 (GRCm39) missense possibly damaging 0.71
IGL03046:Muc5ac UTSW 7 141,348,950 (GRCm39) missense probably benign 0.27
PIT4515001:Muc5ac UTSW 7 141,361,153 (GRCm39) missense probably damaging 0.99
R0092:Muc5ac UTSW 7 141,372,367 (GRCm39) missense possibly damaging 0.72
R0145:Muc5ac UTSW 7 141,349,012 (GRCm39) missense possibly damaging 0.71
R0147:Muc5ac UTSW 7 141,364,776 (GRCm39) missense probably benign 0.08
R0363:Muc5ac UTSW 7 141,354,697 (GRCm39) missense probably benign 0.01
R0384:Muc5ac UTSW 7 141,365,988 (GRCm39) missense possibly damaging 0.71
R0440:Muc5ac UTSW 7 141,345,771 (GRCm39) nonsense probably null
R0583:Muc5ac UTSW 7 141,361,345 (GRCm39) missense probably damaging 0.99
R0616:Muc5ac UTSW 7 141,349,981 (GRCm39) missense probably benign 0.02
R0682:Muc5ac UTSW 7 141,359,406 (GRCm39) missense possibly damaging 0.53
R0685:Muc5ac UTSW 7 141,361,446 (GRCm39) missense probably benign 0.03
R0883:Muc5ac UTSW 7 141,350,002 (GRCm39) missense possibly damaging 0.71
R0924:Muc5ac UTSW 7 141,361,252 (GRCm39) missense possibly damaging 0.68
R1300:Muc5ac UTSW 7 141,370,666 (GRCm39) missense possibly damaging 0.73
R1315:Muc5ac UTSW 7 141,361,060 (GRCm39) missense probably damaging 0.99
R1354:Muc5ac UTSW 7 141,361,114 (GRCm39) missense probably damaging 0.99
R1484:Muc5ac UTSW 7 141,367,629 (GRCm39) splice site probably null
R1599:Muc5ac UTSW 7 141,352,640 (GRCm39) missense possibly damaging 0.52
R1758:Muc5ac UTSW 7 141,355,268 (GRCm39) missense possibly damaging 0.86
R1837:Muc5ac UTSW 7 141,360,823 (GRCm39) missense probably benign 0.00
R1911:Muc5ac UTSW 7 141,350,041 (GRCm39) missense probably benign 0.18
R1922:Muc5ac UTSW 7 141,347,426 (GRCm39) missense probably benign 0.03
R1966:Muc5ac UTSW 7 141,357,113 (GRCm39) missense possibly damaging 0.92
R1994:Muc5ac UTSW 7 141,366,889 (GRCm39) missense possibly damaging 0.93
R2056:Muc5ac UTSW 7 141,345,772 (GRCm39) missense probably benign 0.01
R2126:Muc5ac UTSW 7 141,364,479 (GRCm39) missense possibly damaging 0.84
R2170:Muc5ac UTSW 7 141,366,084 (GRCm39) missense possibly damaging 0.93
R2258:Muc5ac UTSW 7 141,344,745 (GRCm39) missense probably benign 0.41
R2259:Muc5ac UTSW 7 141,344,745 (GRCm39) missense probably benign 0.41
R2293:Muc5ac UTSW 7 141,360,936 (GRCm39) missense probably damaging 0.99
R2435:Muc5ac UTSW 7 141,371,841 (GRCm39) missense possibly damaging 0.53
R2895:Muc5ac UTSW 7 141,344,877 (GRCm39) missense possibly damaging 0.92
R2910:Muc5ac UTSW 7 141,361,378 (GRCm39) missense probably damaging 0.99
R3154:Muc5ac UTSW 7 141,346,473 (GRCm39) splice site probably null
R3762:Muc5ac UTSW 7 141,361,212 (GRCm39) missense possibly damaging 0.53
R3791:Muc5ac UTSW 7 141,352,238 (GRCm39) missense probably benign 0.32
R3806:Muc5ac UTSW 7 141,367,471 (GRCm39) missense possibly damaging 0.91
R3825:Muc5ac UTSW 7 141,368,460 (GRCm39) missense possibly damaging 0.92
R3888:Muc5ac UTSW 7 141,344,961 (GRCm39) missense possibly damaging 0.51
R3929:Muc5ac UTSW 7 141,356,629 (GRCm39) missense probably benign
R3981:Muc5ac UTSW 7 141,367,512 (GRCm39) missense possibly damaging 0.86
R4034:Muc5ac UTSW 7 141,353,581 (GRCm39) critical splice donor site probably null
R4043:Muc5ac UTSW 7 141,361,215 (GRCm39) missense possibly damaging 0.53
R4061:Muc5ac UTSW 7 141,364,867 (GRCm39) missense possibly damaging 0.85
R4106:Muc5ac UTSW 7 141,356,572 (GRCm39) missense possibly damaging 0.86
R4206:Muc5ac UTSW 7 141,370,847 (GRCm39) missense possibly damaging 0.73
R4613:Muc5ac UTSW 7 141,344,840 (GRCm39) missense possibly damaging 0.93
R4719:Muc5ac UTSW 7 141,343,500 (GRCm39) missense possibly damaging 0.83
R4751:Muc5ac UTSW 7 141,371,338 (GRCm39) missense probably benign 0.00
R4789:Muc5ac UTSW 7 141,352,619 (GRCm39) missense possibly damaging 0.86
R4928:Muc5ac UTSW 7 141,371,639 (GRCm39) nonsense probably null
R4971:Muc5ac UTSW 7 141,370,015 (GRCm39) missense possibly damaging 0.68
R4982:Muc5ac UTSW 7 141,363,193 (GRCm39) intron probably benign
R5088:Muc5ac UTSW 7 141,350,056 (GRCm39) missense possibly damaging 0.53
R5141:Muc5ac UTSW 7 141,368,479 (GRCm39) missense possibly damaging 0.72
R5224:Muc5ac UTSW 7 141,347,708 (GRCm39) missense probably benign 0.32
R5366:Muc5ac UTSW 7 141,361,287 (GRCm39) missense probably benign 0.01
R5497:Muc5ac UTSW 7 141,361,380 (GRCm39) missense probably damaging 0.99
R5507:Muc5ac UTSW 7 141,361,569 (GRCm39) missense possibly damaging 0.72
R5643:Muc5ac UTSW 7 141,347,452 (GRCm39) critical splice donor site probably null
R5811:Muc5ac UTSW 7 141,352,721 (GRCm39) missense possibly damaging 0.51
R5946:Muc5ac UTSW 7 141,371,644 (GRCm39) missense possibly damaging 0.73
R5970:Muc5ac UTSW 7 141,344,406 (GRCm39) nonsense probably null
R5977:Muc5ac UTSW 7 141,350,104 (GRCm39) missense possibly damaging 0.73
R6051:Muc5ac UTSW 7 141,365,594 (GRCm39) missense possibly damaging 0.53
R6126:Muc5ac UTSW 7 141,354,969 (GRCm39) missense possibly damaging 0.71
R6159:Muc5ac UTSW 7 141,369,323 (GRCm39) missense possibly damaging 0.53
R6256:Muc5ac UTSW 7 141,343,532 (GRCm39) missense possibly damaging 0.53
R6283:Muc5ac UTSW 7 141,370,601 (GRCm39) nonsense probably null
R6341:Muc5ac UTSW 7 141,355,229 (GRCm39) missense probably damaging 0.99
R6356:Muc5ac UTSW 7 141,366,416 (GRCm39) missense probably benign 0.05
R6481:Muc5ac UTSW 7 141,362,808 (GRCm39) intron probably benign
R6483:Muc5ac UTSW 7 141,356,591 (GRCm39) missense probably benign 0.18
R6627:Muc5ac UTSW 7 141,362,427 (GRCm39) intron probably benign
R6636:Muc5ac UTSW 7 141,372,342 (GRCm39) missense possibly damaging 0.86
R6637:Muc5ac UTSW 7 141,372,342 (GRCm39) missense possibly damaging 0.86
R6656:Muc5ac UTSW 7 141,357,065 (GRCm39) missense probably damaging 0.98
R6721:Muc5ac UTSW 7 141,352,729 (GRCm39) missense possibly damaging 0.71
R6794:Muc5ac UTSW 7 141,363,289 (GRCm39) intron probably benign
R6844:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6847:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6852:Muc5ac UTSW 7 141,370,644 (GRCm39) missense probably benign 0.03
R6862:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6863:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6864:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6865:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6874:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6875:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6876:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6877:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6889:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6920:Muc5ac UTSW 7 141,347,035 (GRCm39) missense possibly damaging 0.86
R6998:Muc5ac UTSW 7 141,372,451 (GRCm39) missense possibly damaging 0.92
R7017:Muc5ac UTSW 7 141,363,424 (GRCm39) intron probably benign
R7091:Muc5ac UTSW 7 141,363,424 (GRCm39) intron probably benign
R7092:Muc5ac UTSW 7 141,363,424 (GRCm39) intron probably benign
R7092:Muc5ac UTSW 7 141,363,385 (GRCm39) intron probably benign
R7110:Muc5ac UTSW 7 141,353,559 (GRCm39) missense possibly damaging 0.95
R7117:Muc5ac UTSW 7 141,367,559 (GRCm39) nonsense probably null
R7238:Muc5ac UTSW 7 141,363,424 (GRCm39) intron probably benign
R7238:Muc5ac UTSW 7 141,363,254 (GRCm39) missense unknown
R7396:Muc5ac UTSW 7 141,362,152 (GRCm39) missense unknown
R7456:Muc5ac UTSW 7 141,346,904 (GRCm39) missense probably benign 0.32
R7477:Muc5ac UTSW 7 141,370,019 (GRCm39) missense possibly damaging 0.72
R7530:Muc5ac UTSW 7 141,367,536 (GRCm39) missense possibly damaging 0.51
R7545:Muc5ac UTSW 7 141,362,405 (GRCm39) missense unknown
R7604:Muc5ac UTSW 7 141,363,446 (GRCm39) missense unknown
R7635:Muc5ac UTSW 7 141,359,413 (GRCm39) missense probably damaging 0.98
R7635:Muc5ac UTSW 7 141,359,490 (GRCm39) missense possibly damaging 0.53
R7650:Muc5ac UTSW 7 141,363,159 (GRCm39) missense unknown
R7651:Muc5ac UTSW 7 141,349,991 (GRCm39) missense possibly damaging 0.92
R7685:Muc5ac UTSW 7 141,363,120 (GRCm39) missense unknown
R7720:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7749:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7750:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7751:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7754:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7798:Muc5ac UTSW 7 141,347,778 (GRCm39) critical splice donor site probably null
R7835:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7837:Muc5ac UTSW 7 141,369,700 (GRCm39) missense possibly damaging 0.53
R7858:Muc5ac UTSW 7 141,357,166 (GRCm39) missense possibly damaging 0.51
R7866:Muc5ac UTSW 7 141,349,589 (GRCm39) missense probably benign 0.00
R7874:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7876:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7877:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7881:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7884:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7921:Muc5ac UTSW 7 141,363,424 (GRCm39) intron probably benign
R7976:Muc5ac UTSW 7 141,363,528 (GRCm39) missense unknown
R8104:Muc5ac UTSW 7 141,358,520 (GRCm39) missense possibly damaging 0.96
R8177:Muc5ac UTSW 7 141,361,068 (GRCm39) missense probably damaging 1.00
R8214:Muc5ac UTSW 7 141,356,685 (GRCm39) missense possibly damaging 0.53
R8292:Muc5ac UTSW 7 141,363,000 (GRCm39) missense unknown
R8386:Muc5ac UTSW 7 141,361,371 (GRCm39) missense possibly damaging 0.93
R8400:Muc5ac UTSW 7 141,364,213 (GRCm39) missense probably damaging 0.99
R8504:Muc5ac UTSW 7 141,360,892 (GRCm39) missense probably damaging 1.00
R8709:Muc5ac UTSW 7 141,370,663 (GRCm39) missense possibly damaging 0.96
R8725:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R8727:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R8754:Muc5ac UTSW 7 141,354,008 (GRCm39) missense possibly damaging 0.85
R8769:Muc5ac UTSW 7 141,372,609 (GRCm39) missense probably damaging 1.00
R8933:Muc5ac UTSW 7 141,343,493 (GRCm39) missense possibly damaging 0.59
R8939:Muc5ac UTSW 7 141,347,091 (GRCm39) missense probably damaging 0.98
R9049:Muc5ac UTSW 7 141,362,712 (GRCm39) missense unknown
R9124:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9131:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9132:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9135:Muc5ac UTSW 7 141,352,218 (GRCm39) missense probably damaging 0.99
R9156:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9157:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9159:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9160:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9161:Muc5ac UTSW 7 141,353,026 (GRCm39) missense possibly damaging 0.53
R9175:Muc5ac UTSW 7 141,366,093 (GRCm39) missense possibly damaging 0.92
R9183:Muc5ac UTSW 7 141,352,637 (GRCm39) missense possibly damaging 0.71
R9218:Muc5ac UTSW 7 141,361,098 (GRCm39) missense probably damaging 0.99
R9219:Muc5ac UTSW 7 141,370,800 (GRCm39) nonsense probably null
R9239:Muc5ac UTSW 7 141,353,954 (GRCm39) missense probably damaging 0.99
R9246:Muc5ac UTSW 7 141,364,215 (GRCm39) missense probably benign 0.11
R9287:Muc5ac UTSW 7 141,361,626 (GRCm39) missense probably damaging 0.99
R9320:Muc5ac UTSW 7 141,369,255 (GRCm39) missense probably benign 0.01
R9327:Muc5ac UTSW 7 141,365,429 (GRCm39) missense possibly damaging 0.86
R9428:Muc5ac UTSW 7 141,362,559 (GRCm39) missense unknown
R9430:Muc5ac UTSW 7 141,362,569 (GRCm39) missense unknown
R9454:Muc5ac UTSW 7 141,362,431 (GRCm39) missense unknown
R9483:Muc5ac UTSW 7 141,365,465 (GRCm39) nonsense probably null
R9581:Muc5ac UTSW 7 141,363,799 (GRCm39) missense unknown
R9610:Muc5ac UTSW 7 141,350,078 (GRCm39) missense possibly damaging 0.86
R9684:Muc5ac UTSW 7 141,364,798 (GRCm39) missense probably benign 0.41
R9760:Muc5ac UTSW 7 141,360,985 (GRCm39) missense probably benign 0.05
R9778:Muc5ac UTSW 7 141,349,021 (GRCm39) nonsense probably null
X0060:Muc5ac UTSW 7 141,357,070 (GRCm39) missense possibly damaging 0.71
Z1088:Muc5ac UTSW 7 141,365,429 (GRCm39) missense possibly damaging 0.86
Z1088:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
Z1177:Muc5ac UTSW 7 141,371,777 (GRCm39) missense probably benign 0.33
Z1177:Muc5ac UTSW 7 141,362,961 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TCAGGGTAAGTATAGGGTCTGATCG -3'
(R):5'- AAACCCAGGTTGGTCTCACC -3'

Sequencing Primer
(F):5'- TAAGTATAGGGTCTGATCGTGGAAC -3'
(R):5'- TCTCACCAACGATGAAGAAGGTTG -3'
Posted On 2022-09-12