Incidental Mutation 'R9644:St18'
ID 726114
Institutional Source Beutler Lab
Gene Symbol St18
Ensembl Gene ENSMUSG00000033740
Gene Name suppression of tumorigenicity 18
Synonyms Nzf3, Myt3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9644 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 6487231-6860940 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 6859052 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 56 (T56I)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043578] [ENSMUST00000131494] [ENSMUST00000140079] [ENSMUST00000150761] [ENSMUST00000151281] [ENSMUST00000163727]
AlphaFold Q80TY4
Predicted Effect probably benign
Transcript: ENSMUST00000043578
SMART Domains Protein: ENSMUSP00000042056
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 365 392 7.8e-15 PFAM
Pfam:zf-C2HC 409 437 4.2e-17 PFAM
Pfam:MYT1 476 713 1.3e-75 PFAM
Pfam:zf-C2HC 721 749 4e-19 PFAM
Pfam:zf-C2HC 765 793 1.7e-19 PFAM
Pfam:zf-C2HC 813 841 1.1e-17 PFAM
Pfam:zf-C2HC 866 893 9.1e-15 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000131494
SMART Domains Protein: ENSMUSP00000117789
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140079
SMART Domains Protein: ENSMUSP00000118322
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150761
SMART Domains Protein: ENSMUSP00000120298
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151281
SMART Domains Protein: ENSMUSP00000122055
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163727
SMART Domains Protein: ENSMUSP00000131417
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 365 392 7.8e-15 PFAM
Pfam:zf-C2HC 409 437 4.2e-17 PFAM
Pfam:MYT1 476 713 1.3e-75 PFAM
Pfam:zf-C2HC 721 749 4e-19 PFAM
Pfam:zf-C2HC 765 793 1.7e-19 PFAM
Pfam:zf-C2HC 813 841 1.1e-17 PFAM
Pfam:zf-C2HC 866 893 9.1e-15 PFAM
coiled coil region 918 987 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C A 4: 152,186,295 S32* probably null Het
Adam34 T A 8: 43,651,729 H293L probably damaging Het
Adgrl3 A G 5: 81,724,189 N910S probably damaging Het
Ankrd11 C T 8: 122,890,943 A2057T probably benign Het
Ankrd36 A G 11: 5,643,835 D480G possibly damaging Het
Aox4 T A 1: 58,228,119 D185E probably benign Het
Apol8 C A 15: 77,749,495 V294L probably damaging Het
Arsk G A 13: 76,072,108 A289V probably damaging Het
Atg101 A G 15: 101,290,566 D184G probably benign Het
Atp10b C T 11: 43,151,832 T73I probably damaging Het
Ccser2 A T 14: 36,879,193 N411K possibly damaging Het
Cct5 A G 15: 31,601,699 S3P probably benign Het
Chn1 A T 2: 73,659,840 I31K probably benign Het
Clec2e T A 6: 129,093,480 I193L probably benign Het
Crim1 G A 17: 78,280,068 G201R probably damaging Het
Ctrc A G 4: 141,845,025 V68A probably damaging Het
Dennd4c T A 4: 86,795,126 I438N probably damaging Het
Dnah5 T A 15: 28,230,504 W183R probably damaging Het
Dnali1 T A 4: 125,056,609 I253F probably damaging Het
Dyrk1b T C 7: 28,182,365 L83P probably damaging Het
Emx2 T C 19: 59,463,995 I237T probably benign Het
Enpp3 C T 10: 24,809,903 R198K probably damaging Het
Epb41l1 C T 2: 156,525,245 P678L possibly damaging Het
Epm2aip1 C T 9: 111,273,069 T370I probably damaging Het
Fam184a T G 10: 53,697,246 Q346P probably damaging Het
Foxi2 A C 7: 135,411,998 H319P possibly damaging Het
Gatad1 A G 5: 3,641,442 V250A possibly damaging Het
Gmeb1 T C 4: 132,232,129 I205V probably benign Het
Gucy2g C G 19: 55,231,105 V362L probably benign Het
Hace1 T C 10: 45,649,905 S281P probably benign Het
Helz C A 11: 107,672,861 A1709D unknown Het
Igf2bp2 T A 16: 22,083,985 N115Y probably damaging Het
Igkv4-86 C T 6: 68,910,609 V49I probably benign Het
Kdm2b A T 5: 122,982,779 V101E probably damaging Het
Kidins220 A G 12: 25,011,019 D790G probably damaging Het
Kif18a A G 2: 109,341,172 T865A probably benign Het
Kif1b A G 4: 149,291,379 V10A probably damaging Het
Kmt2d A T 15: 98,845,504 M3925K unknown Het
Mcee G T 7: 64,411,982 A178S possibly damaging Het
Megf10 A T 18: 57,242,701 H233L probably benign Het
Meox1 T A 11: 101,878,656 E238V probably benign Het
Myo5a G A 9: 75,136,349 G207R probably damaging Het
Nemf T A 12: 69,312,662 N966I possibly damaging Het
Olfr1419 T C 19: 11,871,210 E2G probably benign Het
Olfr1487 G T 19: 13,619,980 A230S probably benign Het
Olfr342 A T 2: 36,527,765 M118L probably damaging Het
Olfr773 A G 10: 129,186,869 I184T possibly damaging Het
Pfas T C 11: 68,992,716 Q662R probably benign Het
Phf2 G T 13: 48,870,742 C8* probably null Het
Pkhd1 T A 1: 20,547,466 N965I probably benign Het
Plxnd1 C T 6: 115,963,313 R1370Q possibly damaging Het
Prdm8 A T 5: 98,185,779 T402S probably benign Het
Proz T A 8: 13,066,854 D135E probably benign Het
Prpmp5 T A 6: 132,312,255 Q202L unknown Het
Prtg T A 9: 72,906,211 I951K probably damaging Het
Rasgef1b A T 5: 99,232,155 Y288* probably null Het
Sacs T A 14: 61,205,979 C1825S probably benign Het
Slc22a12 G C 19: 6,537,643 P427R probably damaging Het
Slfn3 A G 11: 83,214,902 Y575C probably damaging Het
Synrg T C 11: 84,019,870 L876S probably damaging Het
Tchh T C 3: 93,447,359 C1369R unknown Het
Tet2 G A 3: 133,487,303 Q457* probably null Het
Thap12 T C 7: 98,715,288 V221A probably damaging Het
Tor3a T A 1: 156,673,556 D104V probably damaging Het
Trpc2 T C 7: 102,095,232 V737A possibly damaging Het
Trpc4 A G 3: 54,222,278 Y155C probably damaging Het
Tspyl1 T C 10: 34,283,139 S287P possibly damaging Het
Ube2u TAGAAGAAGAAGAAGAAGAAGAAGAAGA TAGAAGAAGAAGAAGAAGAAGAAGA 4: 100,549,746 probably benign Het
Ubr2 A G 17: 46,955,780 probably null Het
Vmn1r238 T A 18: 3,122,635 T260S probably benign Het
Wisp1 T G 15: 66,912,936 C153G Het
Other mutations in St18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:St18 APN 1 6802572 missense probably benign 0.07
IGL00840:St18 APN 1 6833594 missense probably damaging 1.00
IGL01016:St18 APN 1 6844323 missense probably damaging 0.98
IGL01116:St18 APN 1 6802632 missense probably damaging 0.96
IGL01719:St18 APN 1 6845796 splice site probably benign
IGL01885:St18 APN 1 6844372 critical splice donor site probably null
IGL02486:St18 APN 1 6820083 missense probably damaging 1.00
IGL02611:St18 APN 1 6768890 splice site probably benign
IGL02742:St18 APN 1 6802316 splice site probably benign
IGL02953:St18 APN 1 6844113 splice site probably benign
IGL02999:St18 APN 1 6817605 missense probably benign 0.01
IGL03092:St18 APN 1 6768894 splice site probably benign
Smallish UTSW 1 6855473 critical splice donor site probably null
IGL03055:St18 UTSW 1 6802735 missense probably damaging 0.99
R0089:St18 UTSW 1 6848948 missense probably benign 0.02
R0257:St18 UTSW 1 6819962 missense probably benign 0.04
R0383:St18 UTSW 1 6803024 missense probably damaging 1.00
R0588:St18 UTSW 1 6817738 missense probably damaging 0.99
R0989:St18 UTSW 1 6827881 missense probably benign 0.04
R1068:St18 UTSW 1 6795562 missense probably benign 0.01
R1311:St18 UTSW 1 6845644 missense probably damaging 1.00
R1530:St18 UTSW 1 6845569 critical splice acceptor site probably null
R1723:St18 UTSW 1 6810685 splice site probably benign
R1926:St18 UTSW 1 6802689 missense probably benign 0.00
R1927:St18 UTSW 1 6802712 missense probably benign 0.00
R2035:St18 UTSW 1 6802328 missense probably benign 0.00
R2091:St18 UTSW 1 6827971 missense probably benign 0.08
R2139:St18 UTSW 1 6810615 missense possibly damaging 0.85
R2261:St18 UTSW 1 6845572 missense probably damaging 0.96
R2300:St18 UTSW 1 6855402 missense probably damaging 1.00
R2322:St18 UTSW 1 6844124 nonsense probably null
R2846:St18 UTSW 1 6845587 missense probably damaging 0.96
R3738:St18 UTSW 1 6855473 critical splice donor site probably null
R3739:St18 UTSW 1 6855473 critical splice donor site probably null
R3772:St18 UTSW 1 6844329 missense probably damaging 1.00
R3805:St18 UTSW 1 6802353 missense probably damaging 1.00
R3953:St18 UTSW 1 6802893 missense probably damaging 0.99
R4034:St18 UTSW 1 6855473 critical splice donor site probably null
R4036:St18 UTSW 1 6827786 missense probably damaging 1.00
R4407:St18 UTSW 1 6827837 missense probably benign 0.29
R4527:St18 UTSW 1 6855423 missense probably damaging 1.00
R4740:St18 UTSW 1 6817604 missense probably benign
R4838:St18 UTSW 1 6802905 missense probably benign 0.01
R5182:St18 UTSW 1 6817653 missense probably benign 0.03
R5186:St18 UTSW 1 6802317 splice site probably null
R5354:St18 UTSW 1 6844171 missense probably damaging 1.00
R5423:St18 UTSW 1 6802616 missense possibly damaging 0.91
R5724:St18 UTSW 1 6770950 missense probably benign 0.13
R6182:St18 UTSW 1 6844118 splice site probably null
R6491:St18 UTSW 1 6827985 nonsense probably null
R6503:St18 UTSW 1 6795397 missense probably damaging 1.00
R7037:St18 UTSW 1 6803036 missense possibly damaging 0.65
R7098:St18 UTSW 1 6827842 missense probably damaging 1.00
R7132:St18 UTSW 1 6859127 missense
R7144:St18 UTSW 1 6833594 missense probably damaging 1.00
R7150:St18 UTSW 1 6803019 missense probably damaging 1.00
R7334:St18 UTSW 1 6802559 missense probably benign 0.00
R7502:St18 UTSW 1 6827970 missense probably benign 0.09
R7729:St18 UTSW 1 6802537 missense probably benign 0.00
R7848:St18 UTSW 1 6857445 critical splice donor site probably null
R8088:St18 UTSW 1 6828005 missense probably benign 0.00
R8299:St18 UTSW 1 6802992 missense probably benign 0.01
R8338:St18 UTSW 1 6809292 missense probably damaging 1.00
R8690:St18 UTSW 1 6802564 missense probably benign
R8753:St18 UTSW 1 6845791 missense probably damaging 1.00
R8808:St18 UTSW 1 6810602 missense probably damaging 1.00
R8880:St18 UTSW 1 6795395 nonsense probably null
R9055:St18 UTSW 1 6802982 nonsense probably null
R9292:St18 UTSW 1 6827882 missense probably benign 0.32
R9322:St18 UTSW 1 6795523 missense probably benign 0.00
R9530:St18 UTSW 1 6802773 missense probably benign 0.00
R9603:St18 UTSW 1 6845587 missense probably damaging 1.00
R9611:St18 UTSW 1 6802923 missense probably benign 0.00
R9639:St18 UTSW 1 6859022 missense
R9740:St18 UTSW 1 6803063 nonsense probably null
R9750:St18 UTSW 1 6802992 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCTGCAGGGGCCTAATACC -3'
(R):5'- GTGCGCTGTTTGCTAACATCC -3'

Sequencing Primer
(F):5'- TTTTCCCCAGCTGACATAAAAAGG -3'
(R):5'- CTAACATCCTGTGCTTTTGTGAG -3'
Posted On 2022-09-12