Incidental Mutation 'R9644:St18'
ID 726114
Institutional Source Beutler Lab
Gene Symbol St18
Ensembl Gene ENSMUSG00000033740
Gene Name suppression of tumorigenicity 18
Synonyms Nzf3, Myt3
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9644 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 6557455-6931164 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 6929276 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 56 (T56I)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043578] [ENSMUST00000131494] [ENSMUST00000140079] [ENSMUST00000150761] [ENSMUST00000151281] [ENSMUST00000163727]
AlphaFold Q80TY4
Predicted Effect probably benign
Transcript: ENSMUST00000043578
SMART Domains Protein: ENSMUSP00000042056
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 365 392 7.8e-15 PFAM
Pfam:zf-C2HC 409 437 4.2e-17 PFAM
Pfam:MYT1 476 713 1.3e-75 PFAM
Pfam:zf-C2HC 721 749 4e-19 PFAM
Pfam:zf-C2HC 765 793 1.7e-19 PFAM
Pfam:zf-C2HC 813 841 1.1e-17 PFAM
Pfam:zf-C2HC 866 893 9.1e-15 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000131494
SMART Domains Protein: ENSMUSP00000117789
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140079
SMART Domains Protein: ENSMUSP00000118322
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150761
SMART Domains Protein: ENSMUSP00000120298
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151281
SMART Domains Protein: ENSMUSP00000122055
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163727
SMART Domains Protein: ENSMUSP00000131417
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 365 392 7.8e-15 PFAM
Pfam:zf-C2HC 409 437 4.2e-17 PFAM
Pfam:MYT1 476 713 1.3e-75 PFAM
Pfam:zf-C2HC 721 749 4e-19 PFAM
Pfam:zf-C2HC 765 793 1.7e-19 PFAM
Pfam:zf-C2HC 813 841 1.1e-17 PFAM
Pfam:zf-C2HC 866 893 9.1e-15 PFAM
coiled coil region 918 987 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C A 4: 152,270,752 (GRCm39) S32* probably null Het
Adam34 T A 8: 44,104,766 (GRCm39) H293L probably damaging Het
Adgrl3 A G 5: 81,872,036 (GRCm39) N910S probably damaging Het
Ankrd11 C T 8: 123,617,682 (GRCm39) A2057T probably benign Het
Ankrd36 A G 11: 5,593,835 (GRCm39) D480G possibly damaging Het
Aox4 T A 1: 58,267,278 (GRCm39) D185E probably benign Het
Apol8 C A 15: 77,633,695 (GRCm39) V294L probably damaging Het
Arsk G A 13: 76,220,227 (GRCm39) A289V probably damaging Het
Atg101 A G 15: 101,188,447 (GRCm39) D184G probably benign Het
Atp10b C T 11: 43,042,659 (GRCm39) T73I probably damaging Het
Ccn4 T G 15: 66,784,785 (GRCm39) C153G Het
Ccser2 A T 14: 36,601,150 (GRCm39) N411K possibly damaging Het
Cct5 A G 15: 31,601,845 (GRCm39) S3P probably benign Het
Chn1 A T 2: 73,490,184 (GRCm39) I31K probably benign Het
Clec2e T A 6: 129,070,443 (GRCm39) I193L probably benign Het
Crim1 G A 17: 78,587,497 (GRCm39) G201R probably damaging Het
Ctrc A G 4: 141,572,336 (GRCm39) V68A probably damaging Het
Dennd4c T A 4: 86,713,363 (GRCm39) I438N probably damaging Het
Dnah5 T A 15: 28,230,650 (GRCm39) W183R probably damaging Het
Dnali1 T A 4: 124,950,402 (GRCm39) I253F probably damaging Het
Dyrk1b T C 7: 27,881,790 (GRCm39) L83P probably damaging Het
Emx2 T C 19: 59,452,427 (GRCm39) I237T probably benign Het
Enpp3 C T 10: 24,685,801 (GRCm39) R198K probably damaging Het
Epb41l1 C T 2: 156,367,165 (GRCm39) P678L possibly damaging Het
Epm2aip1 C T 9: 111,102,137 (GRCm39) T370I probably damaging Het
Fam184a T G 10: 53,573,342 (GRCm39) Q346P probably damaging Het
Foxi2 A C 7: 135,013,727 (GRCm39) H319P possibly damaging Het
Gatad1 A G 5: 3,691,442 (GRCm39) V250A possibly damaging Het
Gmeb1 T C 4: 131,959,440 (GRCm39) I205V probably benign Het
Gucy2g C G 19: 55,219,537 (GRCm39) V362L probably benign Het
Hace1 T C 10: 45,526,001 (GRCm39) S281P probably benign Het
Helz C A 11: 107,563,687 (GRCm39) A1709D unknown Het
Igf2bp2 T A 16: 21,902,735 (GRCm39) N115Y probably damaging Het
Igkv4-86 C T 6: 68,887,593 (GRCm39) V49I probably benign Het
Kdm2b A T 5: 123,120,842 (GRCm39) V101E probably damaging Het
Kidins220 A G 12: 25,061,018 (GRCm39) D790G probably damaging Het
Kif18a A G 2: 109,171,517 (GRCm39) T865A probably benign Het
Kif1b A G 4: 149,375,836 (GRCm39) V10A probably damaging Het
Kmt2d A T 15: 98,743,385 (GRCm39) M3925K unknown Het
Mcee G T 7: 64,061,730 (GRCm39) A178S possibly damaging Het
Megf10 A T 18: 57,375,773 (GRCm39) H233L probably benign Het
Meox1 T A 11: 101,769,482 (GRCm39) E238V probably benign Het
Myo5a G A 9: 75,043,631 (GRCm39) G207R probably damaging Het
Nemf T A 12: 69,359,436 (GRCm39) N966I possibly damaging Het
Or10q3 T C 19: 11,848,574 (GRCm39) E2G probably benign Het
Or1j14 A T 2: 36,417,777 (GRCm39) M118L probably damaging Het
Or5b123 G T 19: 13,597,344 (GRCm39) A230S probably benign Het
Or6c204 A G 10: 129,022,738 (GRCm39) I184T possibly damaging Het
Pfas T C 11: 68,883,542 (GRCm39) Q662R probably benign Het
Phf2 G T 13: 49,024,218 (GRCm39) C8* probably null Het
Pkhd1 T A 1: 20,617,690 (GRCm39) N965I probably benign Het
Plxnd1 C T 6: 115,940,274 (GRCm39) R1370Q possibly damaging Het
Prb1b T A 6: 132,289,218 (GRCm39) Q202L unknown Het
Prdm8 A T 5: 98,333,638 (GRCm39) T402S probably benign Het
Proz T A 8: 13,116,854 (GRCm39) D135E probably benign Het
Prtg T A 9: 72,813,493 (GRCm39) I951K probably damaging Het
Rasgef1b A T 5: 99,380,014 (GRCm39) Y288* probably null Het
Sacs T A 14: 61,443,428 (GRCm39) C1825S probably benign Het
Slc22a12 G C 19: 6,587,673 (GRCm39) P427R probably damaging Het
Slfn3 A G 11: 83,105,728 (GRCm39) Y575C probably damaging Het
Synrg T C 11: 83,910,696 (GRCm39) L876S probably damaging Het
Tchh T C 3: 93,354,666 (GRCm39) C1369R unknown Het
Tet2 G A 3: 133,193,064 (GRCm39) Q457* probably null Het
Thap12 T C 7: 98,364,495 (GRCm39) V221A probably damaging Het
Tor3a T A 1: 156,501,126 (GRCm39) D104V probably damaging Het
Trpc2 T C 7: 101,744,439 (GRCm39) V737A possibly damaging Het
Trpc4 A G 3: 54,129,699 (GRCm39) Y155C probably damaging Het
Tspyl1 T C 10: 34,159,135 (GRCm39) S287P possibly damaging Het
Ube2u TAGAAGAAGAAGAAGAAGAAGAAGAAGA TAGAAGAAGAAGAAGAAGAAGAAGA 4: 100,406,943 (GRCm39) probably benign Het
Ubr2 A G 17: 47,266,706 (GRCm39) probably null Het
Vmn1r238 T A 18: 3,122,635 (GRCm39) T260S probably benign Het
Other mutations in St18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:St18 APN 1 6,872,796 (GRCm39) missense probably benign 0.07
IGL00840:St18 APN 1 6,903,818 (GRCm39) missense probably damaging 1.00
IGL01016:St18 APN 1 6,914,547 (GRCm39) missense probably damaging 0.98
IGL01116:St18 APN 1 6,872,856 (GRCm39) missense probably damaging 0.96
IGL01719:St18 APN 1 6,916,020 (GRCm39) splice site probably benign
IGL01885:St18 APN 1 6,914,596 (GRCm39) critical splice donor site probably null
IGL02486:St18 APN 1 6,890,307 (GRCm39) missense probably damaging 1.00
IGL02611:St18 APN 1 6,839,114 (GRCm39) splice site probably benign
IGL02742:St18 APN 1 6,872,540 (GRCm39) splice site probably benign
IGL02953:St18 APN 1 6,914,337 (GRCm39) splice site probably benign
IGL02999:St18 APN 1 6,887,829 (GRCm39) missense probably benign 0.01
IGL03092:St18 APN 1 6,839,118 (GRCm39) splice site probably benign
Smallish UTSW 1 6,925,697 (GRCm39) critical splice donor site probably null
IGL03055:St18 UTSW 1 6,872,959 (GRCm39) missense probably damaging 0.99
R0089:St18 UTSW 1 6,919,172 (GRCm39) missense probably benign 0.02
R0257:St18 UTSW 1 6,890,186 (GRCm39) missense probably benign 0.04
R0383:St18 UTSW 1 6,873,248 (GRCm39) missense probably damaging 1.00
R0588:St18 UTSW 1 6,887,962 (GRCm39) missense probably damaging 0.99
R0989:St18 UTSW 1 6,898,105 (GRCm39) missense probably benign 0.04
R1068:St18 UTSW 1 6,865,786 (GRCm39) missense probably benign 0.01
R1311:St18 UTSW 1 6,915,868 (GRCm39) missense probably damaging 1.00
R1530:St18 UTSW 1 6,915,793 (GRCm39) critical splice acceptor site probably null
R1723:St18 UTSW 1 6,880,909 (GRCm39) splice site probably benign
R1926:St18 UTSW 1 6,872,913 (GRCm39) missense probably benign 0.00
R1927:St18 UTSW 1 6,872,936 (GRCm39) missense probably benign 0.00
R2035:St18 UTSW 1 6,872,552 (GRCm39) missense probably benign 0.00
R2091:St18 UTSW 1 6,898,195 (GRCm39) missense probably benign 0.08
R2139:St18 UTSW 1 6,880,839 (GRCm39) missense possibly damaging 0.85
R2261:St18 UTSW 1 6,915,796 (GRCm39) missense probably damaging 0.96
R2300:St18 UTSW 1 6,925,626 (GRCm39) missense probably damaging 1.00
R2322:St18 UTSW 1 6,914,348 (GRCm39) nonsense probably null
R2846:St18 UTSW 1 6,915,811 (GRCm39) missense probably damaging 0.96
R3738:St18 UTSW 1 6,925,697 (GRCm39) critical splice donor site probably null
R3739:St18 UTSW 1 6,925,697 (GRCm39) critical splice donor site probably null
R3772:St18 UTSW 1 6,914,553 (GRCm39) missense probably damaging 1.00
R3805:St18 UTSW 1 6,872,577 (GRCm39) missense probably damaging 1.00
R3953:St18 UTSW 1 6,873,117 (GRCm39) missense probably damaging 0.99
R4034:St18 UTSW 1 6,925,697 (GRCm39) critical splice donor site probably null
R4036:St18 UTSW 1 6,898,010 (GRCm39) missense probably damaging 1.00
R4407:St18 UTSW 1 6,898,061 (GRCm39) missense probably benign 0.29
R4527:St18 UTSW 1 6,925,647 (GRCm39) missense probably damaging 1.00
R4740:St18 UTSW 1 6,887,828 (GRCm39) missense probably benign
R4838:St18 UTSW 1 6,873,129 (GRCm39) missense probably benign 0.01
R5182:St18 UTSW 1 6,887,877 (GRCm39) missense probably benign 0.03
R5186:St18 UTSW 1 6,872,541 (GRCm39) splice site probably null
R5354:St18 UTSW 1 6,914,395 (GRCm39) missense probably damaging 1.00
R5423:St18 UTSW 1 6,872,840 (GRCm39) missense possibly damaging 0.91
R5724:St18 UTSW 1 6,841,174 (GRCm39) missense probably benign 0.13
R6182:St18 UTSW 1 6,914,342 (GRCm39) splice site probably null
R6491:St18 UTSW 1 6,898,209 (GRCm39) nonsense probably null
R6503:St18 UTSW 1 6,865,621 (GRCm39) missense probably damaging 1.00
R7037:St18 UTSW 1 6,873,260 (GRCm39) missense possibly damaging 0.65
R7098:St18 UTSW 1 6,898,066 (GRCm39) missense probably damaging 1.00
R7132:St18 UTSW 1 6,929,351 (GRCm39) missense
R7144:St18 UTSW 1 6,903,818 (GRCm39) missense probably damaging 1.00
R7150:St18 UTSW 1 6,873,243 (GRCm39) missense probably damaging 1.00
R7334:St18 UTSW 1 6,872,783 (GRCm39) missense probably benign 0.00
R7502:St18 UTSW 1 6,898,194 (GRCm39) missense probably benign 0.09
R7729:St18 UTSW 1 6,872,761 (GRCm39) missense probably benign 0.00
R7848:St18 UTSW 1 6,927,669 (GRCm39) critical splice donor site probably null
R8088:St18 UTSW 1 6,898,229 (GRCm39) missense probably benign 0.00
R8299:St18 UTSW 1 6,873,216 (GRCm39) missense probably benign 0.01
R8338:St18 UTSW 1 6,879,516 (GRCm39) missense probably damaging 1.00
R8690:St18 UTSW 1 6,872,788 (GRCm39) missense probably benign
R8753:St18 UTSW 1 6,916,015 (GRCm39) missense probably damaging 1.00
R8808:St18 UTSW 1 6,880,826 (GRCm39) missense probably damaging 1.00
R8880:St18 UTSW 1 6,865,619 (GRCm39) nonsense probably null
R9055:St18 UTSW 1 6,873,206 (GRCm39) nonsense probably null
R9292:St18 UTSW 1 6,898,106 (GRCm39) missense probably benign 0.32
R9322:St18 UTSW 1 6,865,747 (GRCm39) missense probably benign 0.00
R9530:St18 UTSW 1 6,872,997 (GRCm39) missense probably benign 0.00
R9603:St18 UTSW 1 6,915,811 (GRCm39) missense probably damaging 1.00
R9611:St18 UTSW 1 6,873,147 (GRCm39) missense probably benign 0.00
R9639:St18 UTSW 1 6,929,246 (GRCm39) missense
R9740:St18 UTSW 1 6,873,287 (GRCm39) nonsense probably null
R9750:St18 UTSW 1 6,873,216 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCTGCAGGGGCCTAATACC -3'
(R):5'- GTGCGCTGTTTGCTAACATCC -3'

Sequencing Primer
(F):5'- TTTTCCCCAGCTGACATAAAAAGG -3'
(R):5'- CTAACATCCTGTGCTTTTGTGAG -3'
Posted On 2022-09-12